Please answer question 3 genetics assignment worksheet·y2 [Compatibility Mode] a
ID: 124469 • Letter: P
Question
Please answer question 3
genetics assignment worksheet·y2 [Compatibility Mode] a Search in Document Home Insert Design Layout References Mailings Review View + Share A Times New Ro… 12 | A A . AaBbCeDdE No Spacing Paste Emptwsis Styles Pane Hending 1 Streng 3The ropstrand of the 3cquerce provided in quation 1 onoodos gme. The amow indicates the paumuter and its direction. The aterisk indicates the teminatoc. Write the RNA strund that is escoded by this gene. Indicue the 5" and 3 ends . Compare and ootrust eaxscription, repicamow, und ranslation Function of the Do no copy from the tet. Use your awn 4. Bolow is a strand of mRNA· s) Crclc the codoms in the Tuding frame. b) Using the codon table in your teboos detenmine theamino zcid sequence it CNA Pahymerase 5' A GAUGGUCAUGCG G A ULUA AGUA AUA 3 Heicese Rbosome actors 2. Belowis a strand of DNA. Write the sequence of the complemectary DNA strand. Indicate the S. end 3. end (NOTE: Spacing is nly fr o nization.) Page 2 of 2 232 Words Polish 93%Explanation / Answer
m-RNA strand from the above DNA stand is
5' UACACGGGAAUGUCAUCGAU 3'
As the A is an terminator, so the mrna won't be formed further from the A with the asterisk. The gene will be coded in 5' to 3' direction.
Related Questions
Hire Me For All Your Tutoring Needs
Integrity-first tutoring: clear explanations, guidance, and feedback.
Drop an Email at
drjack9650@gmail.com
drjack9650@gmail.com
Navigate
Integrity-first tutoring: explanations and feedback only — we do not complete graded work. Learn more.