Academic Integrity: tutoring, explanations, and feedback — we don’t complete graded work or submit on a student’s behalf.

E. TAGGTGAAAGAAATCAGTTA UT EID: 4-38. The human RefSeg of the entire first exon

ID: 132616 • Letter: E

Question

E. TAGGTGAAAGAAATCAGTTA UT EID: 4-38. The human RefSeg of the entire first exon of a gene involved in Brugada syndrome (a cardac disorder characterized by an abnormal electrocardiogram and an increased risk of sudden heart failure) is shown. The first exon includes the start codon. The genomic DNA of four people (1-4) was subjectesd to sequencing. The following sequences represent all those obtained from each person Nucledtides different from the RefSeq are underlined. RefSeq 5 CA ACG CTT AGG ATG TGC GGA GCC T3 Individual 1: 5' CA ACG CTT AGG ATG TGC GGA GCCT3 5' CA ACG CTT AGG ATG TGC GGA GAC 73 Individual 2 5' CA ACG CTT AGG ATG TGA GGA GCC T 3 Individual 3: 5 CA ACG CTT AGG ATG TGC GGA GCC T3 5' CA ACG CTT AGG ATG GCG GAG CCT3 Individual 4 5' CA ACG CTT AGG ATG TGC GGA GCC T3' 5' CA ACG CTT AGG ATG TCT GGA GCC T3' 34. Which individuals show SNP compared to RefSeq? B. 1, 3 D. 1, 2, 4 35. What is the nature of mutation in individual 1? sense sense E silent shift 36. What is the nature of mutation in individual 2? A. nonsense B. missense C. silent D. frameshift 37. What is the nature of mutation in individual 3? A. nonsense B. missense C. silent D. frameshift

Explanation / Answer

Please find the answers below:

Answer 34: Choice D (SNP refers to single nucleotide polymorphism which includes change in single nucleotide in the sequence, hence individuals 1, 2 and 4)

Answer 35: Choice B (The original triplet of nucleotide encodes for amino acid alanine while mutated sequence encodes for asparagine, hence a mis-sense mutation)

Answer 36: Choice A (Since the original sequence encodes for amino acid cystein while the mutated sequence is non-coding in nature, it will become a stop codon, hence a non-sense mutation)

Answer 37: Choice D (The concurrent change in the codons leads to alteration of the whole reading frame of the sequence, hence a frame-shift mutation)