Academic Integrity: tutoring, explanations, and feedback — we don’t complete graded work or submit on a student’s behalf.

Please answer this multiple-part question regarding probe synthesis and nucleic

ID: 142520 • Letter: P

Question

Please answer this multiple-part question regarding probe synthesis and nucleic acid hybridization:

a) DNA (or RNA) molecules are generally radiolabeled by using an isotope that is a component of the ____________and the common isotopes used are ________.

A. bases/14-C and 15-N

B. phosphates/ 32-P and 17-N

C. pentose sugar/ 14-C and 15-O

D. bases or phosphates/32-P and 3-H

b) You want to test if new DNA has been synthesized in cells treated with a drug, you would grow the cell in the presence of 32P-labeled ________.

A. ATP

B. dGTP

C. CTP

D. dTTP

E. UTP

c) Your probe is labeled with biotin; you should trace the probe using ________.

A. X-ray films

B. streptavidin

C. a fluorescent microscope

D. a beta or optical scanner

E. enzyme-linked antibodies

d) You cut a piece of DNA with EcoRI and want to end-label the DNA with 32P. You would use nucleotides labeled at the _______ and the enzyme __________ to complete the job.

A. beta phosphate/ polynucleotide kinase (PNK)

B. alpha phosphate/DNA polymerase

C. gamma phosphate/ DNA ligase

D. any of these/ any of these

e) The molecule 5’CCCCAUUGAUGGCGAAUUGC3’ is attached to a membrane. The membrane is a _____________. A. Southern blot

B. Northern blot

C. Western blot

D. Northern or southwestern blot

Explanation / Answer

A. OPTION D is the correct answer

B. OPTION C is the correct answer

C OPTION B  is the correct answer

It is an affinity based DNA-binding proteins detection system.

D OPTION B is the correct answer

E OPTION A  is the correct answer

Southren blotting is a procedure for identifying specific sequences of DNA.

Hire Me For All Your Tutoring Needs
Integrity-first tutoring: clear explanations, guidance, and feedback.
Drop an Email at
drjack9650@gmail.com
Chat Now And Get Quote