The following cartoon shows a zoomed-in view of RNA polymerase synthesizing mRNA

Question

The following cartoon shows a zoomed-in view of RNA polymerase synthesizing mRNA. Which statement is FALSE? GTP would be the next NTP used in synthesizing the mRNA chain. Although it is not labeled, the 3' end of the mRNA is the end inside the RNA polymerase enzyme. This picture shows the elongation phase of transcription. The mRNA is being synthesized in the 5' to 3' direction. The following region of DNA shows the promoter sequences (underlined) as well as the + 1 transcription start site (in bold) Please notice that only the coding strand of DNA is shown here! 5'CGGACAGAGCAATTGCCTTCTGAGCAATCGGTCACTGGTTGAATCCAGTACAA3' Which statement is FALSE? A change in die -35 consensus sequence such that the first C were replaced by a T would enhance the frequency with which downstream genes are transcribed. A change in the TATA box consensus sequence such that the first A were replaced by a T would increase the strength of this promoter. The sigma factor of RNA polymerase allows the enzyme to bind to the -35 and TATA box sequences. The sequence of the RNA transcript for the portion o f the gene shown here would be 5' UGACCAACUUAGGUCAUGUU... 3'.

Explanation / Answer

Please rate - thanks

a. is FALSE

Because the next NTP should be UTP, not GTP.

d. is FALSE

The mRNA transcript should mimic the coding strand. Shown is the complementary strand. In other words, it is the other strand, the 3'---5' that is used as template to generate the mRNA as that mimics the coding strand. The mRNA should look like this: 5'-ACUGGUUGAAUCCAGUACAA....3' (now this looks like the original coding strand.)

Related Questions

Navigate

• Browse (All)
• Browse T
• Subjects

---

---

Integrity-first tutoring: explanations and feedback only — we do not complete graded work. Learn more.