The heme group in each subunit of hemoglobin is bonded to the enzyme by a crucia

Question

The heme group in each subunit of hemoglobin is bonded to the enzyme by a crucial histidine residue. The non-template strand of part of an exon including the crucial histidine of the a-hemoglobin subunit is shown below. Write the correct transcription product from this gene sequence. A proposed mutation (shown below in bold and underlined) would result in a conformation change in the subunit that would alter the interaction between the crucial histidine and the heme group. In this mutant, the Fe atom of the heme would bind effectively to the histidine, however, the Fe would be forced into the plane of the heme in the absence of O2 instead of being positioned outside of the heme plane. Indicate the molecular consequences of the mutation on the 1 sequence of the polypeptide, and describe what effects this mutation might have on overall hemoglobin activity.

Exon 2 of normal (wild-type) copy

TACGTCCACCCGGACCTCCGGGC

Exon 2 of mutant copy

TACGTCCACCCGGAGCTCCGGGC

Explanation / Answer

Hemoglobin is a protein molecule found in the red blood cells (RBC). Their main function is to carry oxygen (O2) from the lungs to other body organs and return carbon dioxide (CO2) from body organs to lungs. Hemoglobin is a globulin protein with a quaternary structure. Each heme group constitutes one iron atom which binds to one O2 molecule through ion-induced dipole force. It contains four polypeptide subunits, namely, two alpha and two beta chains. These polypeptide chain sequences are conserved. The wild-type primary sequence of the polypeptide is TACGTCCACCCGGACCTCCGGGC . If there is any variation resulting in the mutation of the wild-type copy, for example, a change in the single nucleotide as shown- TACGTCCACCCGGAGCTCCGGGC ; it would result in a frameshift in the open reading frame of this sequence. This frameshift causes missense mutation and leads to the formation of a different protein. Sickle cell anemia is one such genetic disease caused by a single point mutation resulting in a frameshift. This single point mutation in the beta hemoglobin gene converts GAG codon into GUG, this results in a missense mutation and valine is formed instead of glutamic acid.

Related Questions

Navigate

• Browse (All)
• Browse T
• Subjects

Integrity-first tutoring: explanations and feedback only — we do not complete graded work. Learn more.