Academic Integrity: tutoring, explanations, and feedback — we don’t complete graded work or submit on a student’s behalf.

in the . This 36 amino acid long peptide is a potent vasoconstrictor eftect on f

ID: 147718 • Letter: I

Question

in the . This 36 amino acid long peptide is a potent vasoconstrictor eftect on fat storage. The sequence of the entire mRNA sequence of including 5' and 3' non-template sequence is shown below. A mutation (next to the asterisk) to change to a thymine The neuropeptide Y molecule is expressed in brain neurons sympathetic nervous s an neuropeptide Y in the gene can cause a guanine in the gene In the normal gene, this guanine is part of a codon that codes for a g acid/ glutamate. A genetic codon table is provided below a. Indicate the proper reading frame for this gene at the mutation site (don't show the reading frame for the entire sequence - just one codon). 1o double-check your work, here is an additional piece of information. The first three amino acids in neuropeptide Y are Y, P, S b. Indicate the consequences of the described mutation on the final peptide sequence GCACCCCATCCGCTGGCTCTCACCCCTCGGAGACGCTCGCCCGACAG CATAGTACTTGCCGCCCAGCCACGCCCGCGCGCCAGCCACCATGCTA GGTAACAAGCGACTGGGGCTGTCCGGACTGACCCTCGCCCTGTCCCT GCTCGTGTGCCTGGGTGCGCTGGCCGAGGCGTACCCCTCCAAGCCGG ACAACCCGGGCG AGGACGCACCAGCGGAGGACATGGCCAGATACTA CTCGGCGCTGCGACACTACATCAACCTCATCACCAGGCAGAGATATG GAAAACGATCCAGCCCAGAGACACTGATTTCAGACCTCTTGATGAGA GAAAGCACAGAAAATGTTCCCAGAACTCGGCTTGAAGACCCTGCAAT GTGGTGATGGGAAATGAGACTTGCTCTCTGGCCTTTTCCTATTTTCA GCCCATATTTCATCGTGTAAAACGAGAATCCACCCATCCTACCAATG CATGCAGCCACTGTGCTGAATTCTGCAATGTTTTCCTTTGTCATCAT TGTATATATGTGTGTTTAAATAAAGTATCATGCATTCAAAAGTGAAA Table of mRNA codons Second Base Third Base First phenylalanine serine phenylalanine scrine cysleine cysicine STOP tryptophan tyrosine STOP STOP proline proline histidine histidine lcucine ewinlinpia leucine proline glutamine arginine erine isolcucine isolcucine isoleucine START thrconine aspuragine threonine asparagine thrconine lysine threonine lysine senne glycine glycine glycine alanine valine valine

Explanation / Answer

the sequence of the peptide is TAC CCC TCC AAG CCG GAC AAC CCG GGC GAG

Y P S K P D N P G

Mutation is of substitution type thus if the G just next to asterik change into thymine then the codon will be GAT which codes for aspartic acid D. if the codon G just before the asterik change into T then the codon will TAG which is a stop codon and the translation of the protein will immediately stops here resulting in truncated protein.