24. In the sequence comparison below, the human sequence, top, is translated wit

Question

24. In the sequence comparison below, the human sequence, top, is translated with the amino acids placed above the DNA strand; the mouse sequence is below; based on the indels (represented by-), it can be deduced tha... CCTCAGCCCTGCCTGTCTCCCAGATCACTGTCCTTCTGCCATGGCCCTGTGGATGCGCCT CCTCAACCCAGCCTATCTTCCAGGTTATTGT--TTC-AACATGCCCCTGTGGATGCGCTT a. the mouse sequence, after the deletions, is frame-shifted and nonfunctional. b. the mouse sequence, after the deletions, succumbs to a premature termination. c. the mouse sequence, after the three deletions, demonstrates similarity from H on. d. the mouse sequence is the same to the human sequence except for the loss of 3 aas, e. none of the above

Explanation / Answer

The accurate answer would be b. the mouse sequence, after the deletions, succumbs to a premature termination.

Reason:

Upon following the open reading frame of the mouse sequence, one can note that after the third deletion, the ORF reads CAA. This when transcribed would form UAA, one of the three stop codons of translation (the other two being UGA and UAG). Therefore in the mouse sequence, the amino acid chain will stop after the third deletion and come to a premature termination.

Related Questions

Navigate

• Browse (All)
• Browse 2
• Subjects

---

---

Integrity-first tutoring: explanations and feedback only — we do not complete graded work. Learn more.