Academic Integrity: tutoring, explanations, and feedback — we don’t complete graded work or submit on a student’s behalf.

For the next part of the assignment, you need to take the appropriate sequence b

ID: 150004 • Letter: F

Question

For the next part of the assignment, you need to take the appropriate sequence below (based on the first letter of your last name), and use the nucleotide BLAST function on GenBank () to identify A) What gene was amplified B) From what organism the sequence came (scientific and common name), and C) in which Order that species is taxonomically placed

https://blast.ncbi.nlm.nih.gov/Blast.cgi?PAGE_TYPE=BlastSearch

CTGTGACTTTGCCAAGTGGAGGTGTGTGCTGAAGATCTCAGACAGCTGCCCCACACCTCTTGCCATCGCAGAGAATGCCAACGTACTGGCCAGATATGCCAGCATTTGTCAACAGGTTGGCATCACCCACTCAATAGAAATGACACCCAATTTGCAAGTACTACAATGGCACTCAGTGAAATTTGAACAATGCTAATATGAATCAGCAGC

Explanation / Answer

The gene amplified has following details

A)Phycodurus eques isolate eques1D aldolase-like protein gene, partial cds (coding sequence)

GenBank accession number KM201579.1

B) Phycodurus eques (leafy seadragon) - Source

C) Eukaryota; Metazoa; Chordata; craniata; Vertebrata; Euteleostomi; Actinopterygii; Neopterygii; Teleostei; Neoteleostei; Acanthomorphata; Syngnathiaria; Syngnathiformes; Syngnathoidei; Syngnathidae; Phycodurus

Hire Me For All Your Tutoring Needs
Integrity-first tutoring: clear explanations, guidance, and feedback.
Drop an Email at
drjack9650@gmail.com
Chat Now And Get Quote