Academic Integrity: tutoring, explanations, and feedback — we don’t complete graded work or submit on a student’s behalf.

Here is a different region of the E. coli chromosome, showing two genes transcri

ID: 161827 • Letter: H

Question

Here is a different region of the E. coli chromosome, showing two genes transcribed from promoters pointing in opposite directions (“diverging” promoters). A transcription factor, IlvR, binds within the green box. IlvR is inactive by default, but is made active when it binds to -aceto-lactate (AL). The actual DNA sequence in this region of the chromosome is shown below the drawing.

B. In the presence of AL, IlvR binds to the site indicated in the green box. Describe this regulation with respect to gene1. What would you call IlvR? AL? Now describe the regulation and name IlvR and AL with respect to gene2.

C. Assuming that AL is present, what is the sequence of the first five amino acids that would be translated from this region of the chromosome? What about if AL is not present? (You should start by figuring out which gene will be transcribed, and which DNA strand will be the template strand. Then make the mRNA from that gene. Then find the appropriate ribosome binding site, and finally translate the mRNA into a protein sequence.)

GENE! an,+- GENE2 GENE! CAGATCGCGTAAATCCATAGGGACAGCCCTCGATGTTGATGACGTTGTTAATATAT CAAT rrcCGCAATA GTCTAGCGCATTTAGGTATCCCTGTCGGGAGCTACAACTACTGCAACAATTATATAGTTAAAGGCGTTAT- AATTTCCTGTCATATGGTGAATTCAATCTCGCAAACGCCACGAGGAATCACCATGGCTAACTACTTCAAT 3, TTAAAGGACAGTATACCACTTAAGTTAGAGCGTTTGCGGTGCTCCTTAGTGGTACCGATTGATGAAGTTA 5'

Explanation / Answer

A. IIvR is a transcription factor which has a binding site upstream of the Gene 1.When an inducer acetolactate (AL) binds the IIvR, the complex of IIvR-AL activates the transcription of Gene 1.

Hene in the absence of IIvR-AL, gene 1 will not be transcribed. On the other hand, gene 2 lacks any binding site for IIvR-AL. Thus gene 2 will be transcribed even in the absence of IIvR-AL.

B. IIvR activates the transcription of gene 1, hence it can be named as an activator. AL induces the binding if IIvR at the upstream site, hence it can be named as an inducer. The complex IIvR-AL acts as a positive regulator of gene 1. Only when this complex is present, gene 1 will be transcribed. Therefore gene 1 is an inducible gene.

In the presence of diverging promoters, the transcription of gene 1 and gene 2 is tightly regulated because of the IIvR-AL complex. In its absence, only gene 2 is transcribed. Therefore with respect to gene 2, IIvR-AL is a negative regulator. IIvR is an inactivator and AL is a repressor.

C. In presence of AL, gene 1 will be transcribed. In absence of AL, gene 2 is transcribed.

Hire Me For All Your Tutoring Needs
Integrity-first tutoring: clear explanations, guidance, and feedback.
Drop an Email at
drjack9650@gmail.com
Chat Now And Get Quote