In-Fusion Cloning Human caveolin-2 (Cav2) and caveolin-3 (Cav3) are homologous m
ID: 163177 • Letter: I
Question
In-Fusion Cloning
Human caveolin-2 (Cav2) and caveolin-3 (Cav3) are homologous membrane proteins which are involved in development of certain types of cancers if their cellular expression is misregulated. A caveolin consists of two domains – the N-terminal and the C-terminal - each serving a different functional role. To develop a viable target for pharmaceutical intervention the interactions of Cav2 and Cav3 with neighboring proteins and each other need to be understood. The research project requires construction and expression of a 150 amino acid chimera protein that has the N-terminal domain of Cav2 and the C-terminal domain of Cav3. For this, you will need to clone 42 C-terminal residues of Cav3 after the 108 N-terminal residues of Cav2. Two plasmids are available, one is an expression vector encoding Cav2, and another is a cloning vector encoding Cav3.
Cav-2 DNA sequence
atggggctgg agacggagaa ggcggacgta cagctcttca
tggacgacga ctcctacagc caccacagcg gcctcgagta cgccgacccc gagaagttcg
cggactcgga ccaggaccgg gatccccacc ggctcaactc gcatctcaag ctgggcttcg
aggatgtgat cgcagagccg gtgactacgc actcctttga caaagtgtgg atctgcagcc
atgccctctt tgaaatcagc aaatacgtaa tgtacaagtt cctgacggtg ttcctggcca
ttcccctggc cttcattgcg ggaattctct ttgccaccct cagctgtctg cacatctgga
ttttaatgcc ttttgtaaag acctgcctaa tggttctgcc ttcagtgcag acaatatgga
agagtgtgac agatgttatc attgctccat tgtgtacgag cgtaggacga tgcttctctt
ctgtcagcct gcaactgagc caggattga
Cav-3 DNA sequence
atg atggcagaag agcacacaga tctcgaggcc cagatcgtca
aggatatcca ctgcaaggag attgacctgg tgaaccgaga ccccaagaac attaacgagg
acatagtcaa ggtggatttt gaagacgtga tcgcagagcc tgtgggcacc tacagctttg
acggcgtgtg gaaggtgagc tacaccacct tcactgtctc caagtactgg tgctaccgtc
tgttgtccac gctgctgggc gtcccactgg ccctgctctg gggcttcctg ttcgcctgca
tctccttctg ccacatctgg gcggtggtgc catgcattaa gagctacctg atcgagatcc
agtgcatcag ccacatctac tcactctgca tccgcacctt ctgcaaccca ctcttcgcgg
ccctgggcca ggtctgcagc agcatcaagg tggtgctgcg gaaggaggtc taa
Design two primers (one forward and one reverse) with properties that are suitable for In-Fusion cloning. Label the vector specific and insert specific parts.
Explanation / Answer
Cav-2 DNA sequence
atggggctgg agacggagaa ggcggacgta cagctcttca
tggacgacga ctcctacagc caccacagcg gcctcgagta cgccgacccc gagaagttcg
cggactcgga ccaggaccgg gatccccacc ggctcaactc gcatctcaag ctgggcttcg
aggatgtgat cgcagagccg gtgactacgc actcctttga caaagtgtgg atctgcagcc
atgccctctt tgaaatcagc aaatacgtaa tgtacaagtt cctgacggtg ttcctggcca
ttcccctggc cttcattgcg ggaattctct ttgccaccct cagctgtctg cacatctgga
ttttaatgcc ttttgtaaag acctgcctaa tggttctgcc ttcagtgcag acaatatgga
agagtgtgac agatgttatc attgctccat tgtgtacgag cgtaggacga tgcttctctt
ctgtcagcct gcaactgagc caggattga
Forward and reverse primers
Forward primers :
CGGCTCAACTCGCATCTC
Reverse primer :
GATTTCAAAGAGGGCATGGCT
This primer pair is going to provide a product size of a 108 bp; as is the requirement of Cav-2 protein.
Cav-3 DNA sequence
atg atggcagaag agcacacaga tctcgaggcc cagatcgtca
aggatatcca ctgcaaggag attgacctgg tgaaccgaga ccccaagaac attaacgagg
acatagtcaa ggtggatttt gaagacgtga tcgcagagcc tgtgggcacc tacagctttg
acggcgtgtg gaaggtgagc tacaccacct tcactgtctc caagtactgg tgctaccgtc
tgttgtccac gctgctgggc gtcccactgg ccctgctctg gggcttcctg ttcgcctgca
tctccttctg ccacatctgg gcggtggtgc catgcattaa gagctacctg atcgagatcc
agtgcatcag ccacatctac tcactctgca tccgcacctt ctgcaaccca ctcttcgcgg
ccctgggcca ggtctgcagc agcatcaagg tggtgctgcg gaaggaggtc taa
Forward and reverse primers
Forward primers :
AGATCCAGTGCATCAGCCAC
Reverse primer :
TGCGGATGCAGAGTGAGTAG
This primer pair is going to give a product length of 42bp as required for Cav-3 protein .
Related Questions
drjack9650@gmail.com
Navigate
Integrity-first tutoring: explanations and feedback only — we do not complete graded work. Learn more.