Academic Integrity: tutoring, explanations, and feedback — we don’t complete graded work or submit on a student’s behalf.

Show below is a double-stranded bacterial ( S. enterica ) DNA sequence coding fo

ID: 165728 • Letter: S

Question

Show below is a double-stranded bacterial (S. enterica) DNA sequence coding for a hypothetical protein. Both are strands are shown: the top strand reads 5' to 3' left to right, while the bottom strand reads 5' to 3' right to left.

NOTE: For this problem, transcription begins with and includes the bolded C/G base pair and RNA polymerase proceeds from left to right along the DNA.

5' GTGTCCGTCTAATATTGTGAGATGTTATATCCCGCCGTCAACACCATCAAACAGGATAATCGCCTGCTGGGGCAAAGGCGGTGAAGGTAAAGGTGTTGCC 3'

3' CACAGGCAGATTATAACACTCTACAATATAGGGCGGCAGTTGTGGTAGTTTGTCCTATTAGCGGACGACCCCGTTTCCGCCACTTCCATTTCCACAACGG 5'

In this cell, which protein recruits RNA polymerase to the promoter?

Explanation / Answer

I don't think that RNA polymerase recruiting protein would vary based on the DNA sequence or the transcription initiation site.

whatever the DNA sequence may be, and whatever the transcription initiation site may be, sigma factor recognizes the promoter sequence and facilititates the binding of RNA polymerase on to the promoter.

Hire Me For All Your Tutoring Needs
Integrity-first tutoring: clear explanations, guidance, and feedback.
Drop an Email at
drjack9650@gmail.com
Chat Now And Get Quote