Academic Integrity: tutoring, explanations, and feedback — we don’t complete graded work or submit on a student’s behalf.

A double-stranded engagement of viral DNA, one of whose strands is shown below,

ID: 173048 • Letter: A

Question

A double-stranded engagement of viral DNA, one of whose strands is shown below, encodes two polypeptides called vir-1 and vir-2. Adding this double stranded DNA fragment to an in vitro transcription and translation system yields peptides of 10 residues (vir-1) and 5 residues (vir-2). 5'-AGATCGGATGCTCAACTATATGATTAACAGATAAAACT-3' (a) What are the nucleotide sequences of the open reading frames (start to stop codons. inclusively) within the mRNA transcripts coding for vir-1 and vir-2? Write them out and designate the 5' and 3'-ends. (b) What is the amino acid sequence of each polypeptide? Use one letter symbols to denote amino acids. (c) In a mutant viral strain, the T at position 23 (counting from the left) on the DNA strand shown above has been replaced with G. Determine the amino acid sequences of the two peptides encoded by the mutant virus. (d) What would be the sequences of the oligonucleotide primers (each 10 bp in length) required to amplify by polymerase chain reaction the DNA open reading frame (start to stop codons. inclusively) corresponding to the vir-1 polypeptide? Be sure to designate the 5' and 3' ends of the primers.

Explanation / Answer

A.      Vir 1- 3’ TCAACTATATGTGATTAACAGAGCCTGCGGCAT 5’

Its reverse transcript which will for coding mRNA will be

5’ ATGCCGCAGGCTCTGTTAATCACATATAGTTGA 3’

Vir-2 - 5’ ATGCTCAACTATATGTGA 3’

B.      Vir-1 M P Q A L L I T Y S Stop

Vir-2 M L N Y M Stop

C.      Vir-1 M P Q A L L I P Y S Stop

Vir-2 Met L N Y Met G L T E P A A Stop

D.      Fw primer 5’ TCAACTATAT 3’

Rv Primer 5’ ATATAGTTGA 3’

Hire Me For All Your Tutoring Needs
Integrity-first tutoring: clear explanations, guidance, and feedback.
Drop an Email at
drjack9650@gmail.com
Chat Now And Get Quote