Creation of target construct The 4.8-kb hLZ genomic sequence, starting from the

Question

Creation of target construct

The 4.8-kb hLZ genomic sequence, starting from the ATG start codon to the TAA stop codon and flanked by two homology arms, was obtained by PCR using the BAC clone RP11-1143G9 (Genome Systems Inc., St. Louis, Mo.) as a template and using the following primers: hLF-hLZ-F (5-CTAGCTAGCAAAGCCCTGAATAAAGGGGCGCAGGGCAGGCGCAAGTGGCAGAGCCTTCGTTTGCCAAGTCGCCTCCAGACCGCAGACATGAAGGCTCTCATTGTTCTG-3) and hLF-hLZ-R (5-CTAGCTAGCAGGGGAGGCCAAGGCCCCAACACACCTGGGGAGAAGAGCTGGGGG CAGTGAATGGCTGAGGCTTTCTTGGGGAGCTGGGCCATCTTCTTCGGTTTTACACTCC ACAACCTTGAAC-3), where homology arms to the hLF gene are in bold, and NheI restriction sites are in italics. The PCR product was cloned into the pMD19-T cloning vector (Takara, Dalian, China) and confirmed by sequencing. A zeocin (Zeo) cassette flanked by two FRT sites for positive selection was blunt-end ligated into the HpaI site in intron 2 of the hLZ gene. The resulting targeting construct, named pMD19-hLZ-Zeo, was linearized with NheI, and the DNA fragments containing hLZ-Zeo were purified for recombineering.

In the Supplementary Materials and Methods under “Creation of targeting construct for recombineering” are listed two very long PCR primers called hLF-hLZ-F and hLF-hLZ-R. Describe the target that is used by these primers in their PCR and calculate the appropriate Tm one needs to use for determining an annealing temperature in the PCR [use Tm= 2(A+T) + 4(G+C) for your estimate]. Briefly explain the reasoning for your answers.

Explanation / Answer

From the primer sequence given here the target DNA contains more C: G compared to A:T content . The melting temperature opf this DNA will be more as more GC content are present. The Tm for hLF-hLZ-F is calculated using Tm= 2(A+T) + 4(G+C) = 2(26+20)+4(32+30)= 340 degreeC. By counting the no. of bases respectively. The Tm for hLF-hLZ-R will be Tm= 2(27+25)+4(24+38) = 350 degrees . So on an average you can consider a range from 330 degrees to 360 degree. Theoretically you can predict exact temperatures. But practically in most cases the annealing temperatuture falls in a range from the theoretical value. So while setting temperature start 3 to 5 degrees lesser and while at the end 3 to 5 degrees longer.

Related Questions

Navigate

• Browse (All)
• Browse C
• Subjects

Integrity-first tutoring: explanations and feedback only — we do not complete graded work. Learn more.