Creation of target construct according to High-level expression of bioactive rec

Question

Creation of target construct according to High-level expression of bioactive recombinant human lysozyme in the milk of transgenic mice using a modified human lactoferrin BAC by Shen Liu

The 4.8-kb hLZ genomic sequence, starting from the ATG start codon to the TAA stop codon and flanked by two homology arms, was obtained by PCR using the BAC clone RP11-1143G9 (Genome Systems Inc., St. Louis, Mo.) as a template and using the following primers: hLF-hLZ-F (5-CTAGCTAGCAAAGCCCTGAATAAAGGGGCGCAGGGCAGGCGCAAGTGGCAGAGCCTTCGTTTGCCAAGTCGCCTCCAGACCGCAGACATGAAGGCTCTCATTGTTCTG-3) and hLF-hLZ-R (5-CTAGCTAGCAGGGGAGGCCAAGGCCCCAACACACCTGGGGAGAAGAGCTGGGGG CAGTGAATGGCTGAGGCTTTCTTGGGGAGCTGGGCCATCTTCTTCGGTTTTACACTCC ACAACCTTGAAC-3), where homology arms to the hLF gene are in bold, and NheI restriction sites are in italics. The PCR product was cloned into the pMD19-T cloning vector (Takara, Dalian, China) and confirmed by sequencing. A zeocin (Zeo) cassette flanked by two FRT sites for positive selection was blunt-end ligated into the HpaI site in intron 2 of the hLZ gene. The resulting targeting construct, named pMD19-hLZ-Zeo, was linearized with NheI, and the DNA fragments containing hLZ-Zeo were purified for recombineering.

In the Supplementary Materials and Methods under “Creation of targeting construct for recombineering” are listed two very long PCR primers called hLF-hLZ-F and hLF-hLZ-R. Describe the target that is used by these primers in their PCR and calculate the appropriate Tm one needs to use for determining an annealing temperature in the PCR [use Tm= 2(A+T) + 4(G+C) for your estimate]. Briefly explain the reasoning for your answers.

Explanation / Answer

Designing of primer is very important for the amplification in the PCR process, for the calculation of annealing temperature we required to calculate the melting temperature by using the formula as

2(A+T)+4(G+C) =2(46) + 4(62) = 92+ 248= 340 is melting temperatures of we subtract 5C it gives annealing temperature,

The annealing temperature is very high so it may be taken any thermophilic micro organisms. F primer

For Z primer it is 2(52)+ 4(70) =104+280 =384 is melting temperatures where calculated so B annealing temperature is minus 5 C,

It having high GC content so it have high genome stability.

Related Questions

Navigate

• Browse (All)
• Browse C
• Subjects

Integrity-first tutoring: explanations and feedback only — we do not complete graded work. Learn more.