You are given a sample of template (cDNA) and you want to amplify and clone the

Question

You are given a sample of template (cDNA) and you want to amplify and clone the following sequence (333bp ORF, see below)-into the vector from question 1 above- in bacteria. You intend to do sticky ended ligation having an insert with restriction sites. You have done sequence analysis on your insert and you know that none of the restriction sites listed above arc found within your ORF-quite important, because you wouldn't want to cut within your insert. You would want to design forward and reverse primers that arc 18-24 bases long containing the requisite restriction sites at both ends of the insert plus an anchor sequence (6 extra bases upstream of restriction sites-TAACiCA on forward primer and TGCTAA on reverse primer). You are given everything you need, including enzymes, buffers and competent cells. Tell us what you would do (including how you would set-up the required reactions and steps), clearly, step-by-step, and show data that supports what you were able to accomplish at every major step of the process. Sketch data (pictures, diagrams) and explain to convince your colleagues that you were able to clone the sequence. ATGgccctgtggatgcgcctcctgcccctgctggcgctgctggccctctggggacctgacccagccgcagcctttgtgaaccaacacctgtgcggctcacacctggtggaagctctctacctagtgtgcggggaacgaggcttcttctacacacccaagacccgccgggaggcagaggacctgcaggtggggcaggtggagctgggcgggggccctggtgcaggcagcctgcagcccttggccctggaggggtccctgcagaagcgtggcattgtggaacaatgctgtaccagcatctgctccctctaccagctggagaactactgcaacTAG a) Forward primer: b) Reverse primer:

Explanation / Answer

Forward Primer sequence :

TAGCGGGACACCTACGCGGAG

Reverse Primer sequence :

GATCAACGTCATCAAGAGGT

Forward primer is desinged by taking the complemetary sequence of the first 20 nucleotides of the sense strand.

Reverse primer is designed by the taking antisense strand complementary of last 20 nucleotides.

Related Questions

Navigate

• Browse (All)
• Browse Y
• Subjects

---

---

Integrity-first tutoring: explanations and feedback only — we do not complete graded work. Learn more.