6. Experiment: PCR Given the following DNA sequence for a gene ispD from Yersini

Question

6. Experiment: PCR

            Given the following DNA sequence for a gene ispD from Yersinia pestis, and the sequences of the forward primer A and the reverse primer A, what size band (in base pairs) would you expect to see on a DNA gel after you conducted PCR with this primer set? What size band would you expect to see with forward primer B and reverse primer B? (HINT: If you’re struggling, take a look at https://www.youtube.com/watch?v=tUyBwiyMsSU, at least the first 11 minutes or so, for help. A forward primer matches the target sequence on the forward strand, while the reverse primer is the reverse complement of the target sequence on the forward strand. )

Primer Set A: Forward: 5’ GGTGGATTGCCCTAAGCAGT 3’

                        Reverse: 5’ TCTGGGCGCGTCACTTTAAT 3’

Primer Set B: Forward: 5’ TGGTGGATTGCCCTAAGCAG 3’

                        Reverse: 5’ ACCCCTTCTCTTAACGCACG 3’

Yersinia pestis ispD sequence:

5’ atgagtaacttcgcagtttcccttcctgaagtgatcgctgtattaccggctgcgggtattggtagccgtatgttggtggattgccctaagcagtatttaactgtggggggcaaaacaatcattgaacatgctattttttctttgcttcaccacccacgaattcagcgggttatcgttgtgatccatccgcaggacacacaattctctaggttgtccgttgcgcaggatccacgtatcagtacagtttacggtggcgatcaacgggctaactccgtgatggcgggtttacaattggcagggcaggctgaatgggtgttagttcatgatgcggcacgcccctgtttgcaccttgatgatctcagccggctgttatcgattaccgaatgcagtcaggtggggggaattctggcggcccctgtgcgtgatacgatgaaacgtgccgagccgggtattcaagccatcgctcatacggtggatcgtcaggacctgtggcatgcgctgacgcctcaacttttcccgctagaattattaaaattgtgcttatcccgtgcgttaagagaaggggtggcggtgactgatgaggcctctgcattagagcattgcggttatcatccgatattggttaccggccgttctgataatattaaagtgacgcgcccagaagatctggcattggcggagttttatttaacccagcggcagtctctcaataacgacagtctctga

                                  3’

Explanation / Answer

The amplicon length with primer set A is 588 bp.

The amplicon length with primer set B is 493 bp.

As mentioned in the hint, a forward primer matches the target sequence on the forward strand, while the reverse primer is the reverse complement of the target sequence on the forward strand. Then you can know the amplicon size.

Related Questions

Navigate

• Browse (All)
• Browse 6
• Subjects

Integrity-first tutoring: explanations and feedback only — we do not complete graded work. Learn more.