Academic Integrity: tutoring, explanations, and feedback — we don’t complete graded work or submit on a student’s behalf.

5) You wish to amplify the DNA below, by PCR. You want your PCR product to match

ID: 186740 • Letter: 5

Question

5) You wish to amplify the DNA below, by PCR. You want your PCR product to match the shaded region match. Which of the following primer sets should you use? Explain your answer. catcgatgaattcgagctccaccgcggtggcggccgccagatgcgattacagctccaatcacaaa tgagtcagtcaatcaagtggattcaaagtatagacgacgagttctgcactggcttgctgccaatg tcagaggaaaaccggaagatgtcattacaacaatgtgaatgcaagagattgtgatgagaatactg tctgatgctagctgttcgtgcacaccgtgtcagactttccgtagtgcttcttcgtgaaggagct aatccaacaatattcaataattcggagcgaagtgcccttcat a) Forward primer: 5-gccgccagatgcgattac-3 Reverse primer: 5'-ccgtagtgcttcttegtgaa-3' b) Forward primer: 5'-gccgccagatgcgattac-3 Reverse primer: 5' -ttcacgaagaagcactacgg-3' c) Forward primer: 5'-gccgccagatgcgattac-3 Reverse primer: 5'-ggcatcacgaagaagcactt-3

Explanation / Answer

The correct answer is b) Forward primer : 5'-gccgccagatgcgattac-3' and reverse primer : 5'-ttcacgaagaagcactacgg-3'.

Forward primer is same in all three options and it is same as the first 18 bps of the shaded region. So, it will form complementarity and binds to the first 18 bps of the complementary strand of the shaded region.

The reverse primer 5'-ttcacgaagaagcactacgg-3' is reverse complement of the last 20 bps of the shaded region. So, it will form complementarity and binds to the last 20 bps of shaded region and acts as a reverse primer. In option "A" reverse primer sequence is same as the last 20 bps of the shaded region. so, it can't binds to this region by complementarity. In option "C" reverse primer is complementary sequence of last 20 bps of shaded region. It will bind to the last 20 bps but it can't act as a reverse primer. A reverse primer should be a reverse complement of the last base pairs of the targetted sequence. So, the correct answer is b.

Hire Me For All Your Tutoring Needs
Integrity-first tutoring: clear explanations, guidance, and feedback.
Drop an Email at
drjack9650@gmail.com
Chat Now And Get Quote