Question 3 (Chapter 2 Exercise 2) Genes in eukaryotes are often organized into e

Question

Question 3 (Chapter 2 Exercise 2) Genes in eukaryotes are often organized into exons and introns, which require splicing to produce an mRNA that can be translated. The gene organization is the order of the DNA segments that comprise the gene starting with the promoter, the first exon, the first intron, the second exon, and so on. The interspersed introns can make gene identification difficult in eukaryotes—particularly in higher eukaryotes with many introns and alternative spliced mRNAs. Prediction of many genes and their organization has been based on similarity searches between genomic sequence and known protein amino acid sequences and genomic sequence and the corresponding full-length cDNAs. cDNAs are reverse-transcribed mRNAs and therefore generally do not contain intron sequences. cDNAs (i.e., copied DNA) can be considered mRNAs. A comparison of a genomic sequence (with introns) to its corresponding cDNAs will reveal where introns begin and end. GenBank will contain the genomic sequence and the cDNA sequence. To find out the structure of the gene (i.e., the arrangement of the exons and introns) we simply need to perform a sequence comparison between the genomic sequence and the cDNA sequence. Shown below is a genomic sequence from the species C. elegans. The Basic Local Alignment Sequence Tool (BLAST) can be used to elucidate part of the gene organization (arrangement of exons and introns) of a genomic sequence. BLAST can be used to compare genomic DNA sequence with all RNA sequences (i.e., cDNA sequences) in GenBank. The top hit of the output will be a sequence comparison between your sequence (the query sequence) and the most similar sequence in the database (subject sequence). Subsequent hits will display sequence comparisons between the query sequence and subject sequences that are increasingly less similar. If all hits have 100% identity, use the hit with the most extensive percentage coverage to report on. Use the nucleotide BLAST tool and appropriate databases to construct a schematic diagram that shows the arrangement of introns and exons in the genomic sequence. Remember that the species source of genomic sequence is Caenorhabditis elegans. ATTTTTAAAAATGTACAAAATCAAACGCCCTACAAATCATGTGTGTGAAGAAGAATAATAACTACAT ATCTATTTATATTTACCGAATAAATATATATTCATCAATTAACCTGAAGAACAAACGAATTCGGCTAC AGGCGTCGATCAGTCTCGAATCTAGTAACAACAAGAGAGCAATACGAAAACCGGTAAATCAATAGG GGGAAGCGAAACAGTAGGTACAAATTGGAGGGGAAGCACCAATACATTAGGTGGGGGGTACGACTTG AAAAATGAGCTGATTTTCGAATAGTTAAAGCGATGATCGTGTCCGAAAAACAGTTCATTTTTCAAG ACAACATTGAGACTGGGAGTACGGGGAAGCTCATTTACGGTGAGAGGAATTGGTGAGATCTTTAGA ATATGCTTAAGGAGTTGGGGTGGCTGGAGAAGTTCCTGTAGCCTCCGTGCCGGGATTCGATGGAGA AGTCGTTGCGGCTGGTCCCTTTTCCTTCACTGGTGCTGGATCCTTGGCTGGAAGACATATGCGTGGC TTGACAGTCGATGAGGTGCGAGCCGACGAGTCCTTGTGAACTTCGTATCTGGAAATATTTTACTTAGA TAGCAAATACTAAAATTGTAAAATTACCTCAAAATCTCAGTATCCGGAATGCTCAATTTCTGCTTCA AAACCTGTCCGATGCGAAGATTGACATCATCGCGAGTAGCATCACGAGTCCACAAGGAAACCTTGT CACCCTTTTGACGAACATTCACGACAGCTCCGCAGATGTAGTCTCCGTACTCGTCGAATTGCTCTC CAACAATAGCCATCAACAGCTCCAACCAGTAGTGATCGAGCAATTGCGTTCTTCTCTGAAGCTTCTA TGATTCATTGAATAAAATATATTTCTCAAAACGTACTTGCTTATCGACAACAACCAACCAACGTCCA CCTTGAACGTTGTTGACGTCCTCCCACATTGGCTTGATTCCTTCCTTGAACAAGTAATAATCGGATCC CCAGTTCAATCCTCCGGCAGACTGAATGTGATTGTACAGCGACCAGAAGTCCTCGACAGTGTCGAAA AGTGAAACCATCTGGAAAAAATCGATAAAAGACGTATTTAAAAATCTTCTACCTTCAGACAATCCTC CCATTCCTTGTTACGGTCAGCTTTCAAGTACCAGAGAGCCCAGCGATTCTGGAGGGGGTGTCTGGTGA GAAGCTCTGGAGGAACTGAAGCATCGGACGCATTCACATCGCCGGAAGCTGACAATGCTTTGTTTTCC GCTACGGATGTGCTCATTTAGCTGAAAATAGGTAATATTATATACGATTAGAGCTCGGAAAACGATA AAATAGAGAAGAGTATGAATTTGGTTCAAATAACTCGGATTTTATAGGAAATTTTGTTTTACTGCAC ATTTTCGGCTAGTTTCCAAGCTTTTTAGATTTTTCAAGTGTAATTGGTAACATCGGGCACAATAAAT TGATATTAAAGCTTGGAAAACAATAA Note: The sequence can be found on the publisher's website and Blackboard Course Document folder. In addition to construction of the schematic diagram, answer the following:

a. Give the name and accession numbers of each distinct mRNA produced from this gene.

b. Give the names and accession numbers of the protein product(s).

c. Note the numbering of the sequences in the alignments. Does the database genomic sequence progress in the same direction as the database mRNA? In other words, is it the same orientation (see below): (No) 1 . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 114 = query 61 . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 98 = subject or opposite orientation (below) 1 . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 114 = query 98 . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 61 = subject

d. Consider the alignment of the query sequence and the subject sequence. What does the orientation of the sequences relative to each other tell you about the sequence that was used as the query sequence? They are all going in different directions in than the genomic sequence.

e. Give the amino acid sequences separately translated from each exon sequence of the longest transcript.

f. How many alternative splice variants are associated with this genomic sequence? 3 List their accession numbers.

Explanation / Answer

Answer-

The given sequnce will give the result in nucleotide blast as follow:

Name

Caenorhabditis elegans genome assembly C_elegans_Bristol_N2_v1_5_4 ,scaffold CELN2_scaffold0000094

Sequence ID: LK927634.1

Assession number

LK927634.1

Length: 172920

Please click on the link and it has all the blast information

https://blast.ncbi.nlm.nih.gov/Blast.cgi#alnHdr_687865447

Related Questions

Navigate

• Browse (All)
• Browse Q
• Subjects

Integrity-first tutoring: explanations and feedback only — we do not complete graded work. Learn more.