Academic Integrity: tutoring, explanations, and feedback — we don’t complete graded work or submit on a student’s behalf.

Putting it all together. You have the following plasmid sequence Plasmid backbon

ID: 190901 • Letter: P

Question

Putting it all together. You have the following plasmid sequence Plasmid backbonel - GAATTC - XYZ - GAATTC- Plasmid backbone2 Plasmid backbonel - CTTAAG - XYZ - CTTAAGPlasmid backbone2 Plasmid backbonel- CTTAAG - XYZ -CTTAAG backbone2 You want to insert a gene that have the following sequence, using EcoRI restriction cloning. GCCGTTTCGACGTGACGGATGCGAAGTAGG etc etc CGGCTGGACGAGAGCGGATGGATCGTACGCG CGGCAAAGCTGCACTGCCTACGCTTCATCC etc etc GCCGACCTGCTCTCGCCTACCTAGCATGCGC Q38: Design 2 primers to both amplify out your gene and also make it ready to put into the plasmid backbone? Hint: you can use EcoRI on your PCR product, too. If you added anything, explain why you added something

Explanation / Answer

Forward primer sequence:
5'-ACT GAATTC GCCGTTTCGACGTGACGGA-3'

Length = 19 + 6 + 3
GC content = 54%
Tm = 55.4'C (Only the complemetary region excluding the restriction site and extra 3 nucleotides)

Reverse primer sequence:
5'-ACT GAATTC GCGCAGCTAGGTAGGCG-3'

Length = 17 + 6 + 3
GC content = 71%
Tm = 54.3'C (Only the complemetary region excluding the restriction site and extra 3 nucleotides)

Extra 3-5 nucloetides are to be added to the 5'-end of the primer. This enables proper binding of restricton enzyme to the recognition sites close to ends.