detail at this level, but good for g short videos and explanations of most of th

Question

detail at this level, but good for g short videos and explanations of most of the techniques mentioned in this cha context of clinical testing: pter in www.geneticseducation.nhs.uk/laboratory process-and-testin www.iheworld.com/in-situ-hybridization.htm guidelines for Fragile X diagnosis which highlight the complicati For much detailed information on FISH see: The UK Association for Clinical Genetic Science has issued Best r difficulties of this condition: www.acgs.uk.com/media/908997/frx bpg final nov 2014.pd Self-assessment questions (1) Design 10-nucleotide-long primers to amplify each of the 50 bp sequences underlined so as to produce a 50 bp product. la) - guidance provided at end CCACTCCCCTCGGCCAGGGCCGCGTCAACCAGCTCGGCGGTGTTTTTATCAACGGCAGGTACCAGG AGACTGGCTCCATACGTCCTGGTGCCATCGGCGGCAGCAAGCCCAAGGTGAGCGGGCGGGCCTTGO AAGAGAGAACCCGGGCGTGCCGTCAGGTACTAGGCCCATIAACCTCTCccCGCTTCCTTCCTCCTC CCGccccCAGTGAGTTCCATCAGCCGCATCCTGAGAAGTAAATTCGGGAAAGGTGAAGAGGAGGAG Note that real primers would be 16-25 nucleotides long and would be designd to give a product of a few hundred bp: this is an exercise in getting the postin and orientation of your primers correct. Do it by hand even if you have acces to a primer design program.] 12] Extend Bor table 4.1 to show the progress of the PCR reaction up to cyd 10. (It would be neat to make a spreadsheet to do this). How many CYC

Explanation / Answer

A-

Forward Primer - 5' AGCTCGGCGG 3'

Reverse Primer -5' TATGGAGCCA 3'

B-

Forward primer - 5' GCGTGCCGTC 3'

Reverse primer - 5' GGAGGAAGGA 3'

Related Questions

Navigate

• Browse (All)
• Browse D
• Subjects

---

---

Integrity-first tutoring: explanations and feedback only — we do not complete graded work. Learn more.