4. DNA polymerase is positioned over the following DNA segment (which is part of

Question

4. DNA polymerase is positioned over the following DNA segment (which is part of a much larger molecule), and is moving from RIGHT to LEFT 5... CCTTAAGACTAACTACTTACTGGGATCO . 3' o 1l 002 1033...GGAATTCTGATTGATGAATGACCCTAG ...5 (A) If we assume an Okazaki fragment is made from this segment (025 pts each. I pts. total): ond ,bn,ni a. Which strand (top or bottom) would be used as the template? ootton b. Is the replication fork to the right or to the left of this sequence? tope c. Is helicase moving to from left to right or from right to left? d. Is the RNA primer to the left or the right of this sequence? (B) W rite out the nucleotide sequence of the newly synthesized Okazaki sequence, indicating the parental and the daughter strands, and labeling the 5' and 3' ends. (0.5 pts.)

Explanation / Answer

a) During DNA replication a short new synthesized DNA fragments are formed on the called Okazaki fragments that are formed on the lagging strand of the template. The lagging strand is complementary to the 5'--------3' of parental DNA.

b) Assume that the reading frame is left to right then it direction of translation starts from left side..

c) A double stranded DNA is being separated into single strand by a helicase. It moves from right to left.

d) From the strands the Okazaki fragments can be linked to form a continuous lagging strand, the RNA Primer must be removed and replaced by DNA. TheRNA Primer from the right is complementary and is constant. So it will be from left to right.

Related Questions

Navigate

• Browse (All)
• Browse 4
• Subjects

---

---

Integrity-first tutoring: explanations and feedback only — we do not complete graded work. Learn more.