In the figure, the hyperchromicity (increase in the absorption of UV light by th

Question

In the figure, the hyperchromicity (increase in the absorption of UV light by the DNA molecule as it goes from helix to random coil conformation) of the DNA depends on sequences of the DNA. Suppose that there are 3 DNA sequences:

DNA1: AAAAAAAAAATTTTTTTTTT

DNA2: AAAAAGGGGGCCCCCTTTTT

DNA3: GGGGGGGGGGCCCCCCCCCC

(a) Based off the graph, calculate the enthalpy and entropy values of the DNA 1, 2, and 3.

(b) Explain why they have a higher melting temperature using these thermodynamic parameter and their molecular structures.

Explanation / Answer

(a) Relation between enthalpy and entropy

G = H -TS

Data is insufficient to calculate enthaly and entropy in above question.

(b) Melting teperature of DNA is directly propositional to its GC content .

we can clearly see that the GC content is highest in the DNA 3 that is why the melting tempreture of DNA 3 is higher than DNA 2 and DNA 1.

Related Questions

Navigate

• Browse (All)
• Browse I
• Subjects

Integrity-first tutoring: explanations and feedback only — we do not complete graded work. Learn more.