(4 points) The following questions are based on the wild type DNA sequence shown
ID: 212459 • Letter: #
Question
(4 points) The following questions are based on the wild type DNA sequence shown below. Only one of the strands is used as a template for synthesizing an mRNA with a functional protein coding region. Assume that the entire template strand is transcribed. 4. 3'-TATGCTACTAACGAATTCGACTTAAC-5 5'-ATACGATGATTGCTTAAGCTGAATTG-3 a. What is the sequence of the polypeptide encoded by the mRNA transcribed from this gene? Label the N and C termini. b. You have isolated a point mutation (i.e. insertion, deletion, or substitution of one base pair) in this gene so that it now encodes the mutant protein shown below. N-met-ile-ser-leu-ser-C State the type of mutation that has occurred at the DNA level (transversion, transition, insertion, or deletion) and at the protein level (synonymous, neutral, frameshift, missense, or nonsense). INDICATE ON THE DNA SEQUENCE SHOWN ABOVE EXACTLY WHERE THE MUTATION OCCURRED AND WHICH BASES WERE INSERTED, DELETED, OR CHANGED.Explanation / Answer
ANSWER 4.
DNA Segment: 5' - ATACGATGATTGCTTAAGCTGAATTG - 3'
mRNA Segment: 5' - AUACGAUGAUUGCUUAAGCUGAAUUG - 3' (Start Codon - AUG, Stop Codon - UAA)
Answer a.
Protein Segment: N - MET.ILE.ALA - C
Answer b.
Protein Segment: N - MET.ILE.SER.LEU.SER - C
Original mRNA Segment: 5' - AUACGAUGAUU'A'GCUUAAGCUGAAUUG - 3' (Start Codon - AUG, Stop Codon - UGA)
Base A is inserted between AUU and GCU.
Protein will have underwent a frameshift mutation
Related Questions
Navigate
Integrity-first tutoring: explanations and feedback only — we do not complete graded work. Learn more.