Academic Integrity: tutoring, explanations, and feedback — we don’t complete graded work or submit on a student’s behalf.

RNA Synthesis Lab.pdf - Adobe Acrobat Reader DC File Edit View Window Help Home

ID: 215200 • Letter: R

Question

RNA Synthesis Lab.pdf - Adobe Acrobat Reader DC File Edit View Window Help Home Tools RNA Synthesis Lab.... x Sign In Now bring in the propertRNA-amino acid complex to pairwith the exposed codon in the A site and attach it to the central nucleotide (Fig. 4). Both PandA sites of the ribosome should now be occupied. Atthis time abond forms between the amino acid in the P site and the amino acid in the A site. Detach the amino acid in the P site from its tRNA and place the peg into theopening of the amino acid in the A site (Fig. 5). Theribosome now moves down themRNA a distance of one codon (three nucleotides) so that the uncharged tRNA previously in the P site is expelled from the ribosome and released from themRNA. P site A site P site A site Figure4 Bonding of the second tRNA-amino acid complex to the mRNA in the A site. Figure 5 Transfer of the amino acid(s) to the A site, thereby engthening the incomplete protein O Type here to search 11:11 AM 3/25/2018

Explanation / Answer

mRNA         5'AUGCCGUGUGAUAGCGCAUUUUGA'3

Polypeptide met----pro---cys--Asp-ser---ala--phe--STOP