The following “mystery” sequences were obtained from DNA extracted from animal b

Question

The following “mystery” sequences were obtained from DNA extracted from animal bones in a glacier in the arctic that are estimated to be >10,000 years old.

1) Can you identify any genes in these sequences? Are there any introns? Why do you say that? What is a plausible biological explanation for this?

2) What species do they most likely belong to?

3) What is the most likely closest living relative of each species?

4) Can you deduce any protein sequence encoded in these sequences? Based on the sequences provided, are these each likely to encode a functional protein? Why or why not? Show your methods and the results that led to these conclusions.

Sequence 1: >sequence1 gtaaatttctatggcctatccgttacaactgggattccaagatgccacatctcctgttatagaa gaactccttcacttccatnarcataccctaataattattttccttattagctccttagtcttgt atattatcatacttatattaactactaagctagtccacacaaatataataaacgtccaagagat agaaataatctgaaccattcttccagctattatccttattttaattgccctgccctctctacac actttatatatagtagatgaaattaataaccccctactaacaatcaaaaccataggacaccaat gattctggagctatgaatatactgattacgaagatttagctttcgactcatacataatcactac tgatagcctaaaatttggagaacttcgattactagaagtagacaatcgaatggtactacctaca gatctcccagttcgagtattagtctcatcagaagatgtcctccattcatgggctgtcccatcct taggtctaaaaacagatgcaattccaggacgacttaatcaagtaactttaacatcaatacgacc tggtttattctatggtcaatgttccgaaatctgtggggcaaatcatagctttataccaattgtc ctagaactagttccacttaagtactttgaaagctggtcagcatcactagcataatcatta

Sequence 2: (found deep in a glacier near some fossilized Quercus garryana residue) >sequence2 cccactgcttanaattgttaatcactcttttattgacctacctgccccctctaacatctcagcc tgatgaaactttggctccctccttggactttgccttctaatccaaattctaaccggcctatttc tagctatacactacacatctgatacagcaacagctttctcctccgtgactcacatctgccgaga cgtaaactatggctgactgattcgatacatgcatgctaacggcgcctctctatttttcatttgc ttattccttcatgtgggtcgagggctttactatgggtcctacacttattttgaaacctgaaacg ttggagttattcttctttttgcagtaatagcaactgcttttataggctatgtcctaccgtgagg acaaatatcattttgaggtgcaacagtcatcaccaacctcttatcagctatcccctatattggc actactctagtagaatgaatctgaggtgggttctcagtcgacaaagcaactttaacacgatttt tcgcctttcacttcattctgccttttatcgttgcagctttagtcatagtccacttattatttct ccacgaaacaggatccaacaacccgtccggcctaatctctgattctgataagatcccatttcat ccctactacacaattaaagatgtattaggtgttctccttctattactcttatttatgattctag ttctattttcccc

Explanation / Answer

Well, this question refers to a series of bioinformatical analysis.

1) You can simply put those two sequences to NCBI -BLAST programme and thereby you can have the idea that how much similarity two sequences have with the existing species database. So you can predict their close relative species on earth.

2) You can also paste two sequences into MULTIPLE SEQUENCE ALIGNMENT programme and thereby you can have an idea about closeness or difference between those two sequences. So you can tell whether those two sequences are from the same species or from two different species.

3) You can again paste the sequences to EXPASY programme and it will translate the nucleotide sequence into coding amino acid sequences. So thereby you can say whether these two sequences encode a functional protein or not.

Now follow this steps accordingly and you will get your results wanted in Q-4.

If you still find any problem to do that, please let me know.

Related Questions

Navigate

• Browse (All)
• Browse T
• Subjects

Integrity-first tutoring: explanations and feedback only — we do not complete graded work. Learn more.