Academic Integrity: tutoring, explanations, and feedback — we don’t complete graded work or submit on a student’s behalf.

Use the following image of a nucleotide and the answer list below it to answer t

ID: 218170 • Letter: U

Question

Use the following image of a nucleotide and the answer list below it to answer the noxt 4 questions: O-P-O-P-O-PO-GH ?? 16. The nuclootide above could be incorporated into which of the tollowing? A) DNA B) messenger RNA C) transfer RNA D) B and C E) A,Band C 17. if the nucleotide A, B, C, D, or E? were incorporated into an extending nucleic acid chain, where would it attach? wn oporated s par of a nuclai did hain, which par of cdlobdl can baso- ir A, B, C, D, or E? 19 Whan inorporated as part of a nucleic acid chain,to which part of the nucleotlde would the noxt nucleotide attach? A, B, C, D, or E? 20. The tryptophan tRNA anticodon sequence is A) 5' UGG 3 B) 5'ACC 3 C) 5' GGU 3 D) 5' CCA 3 E) None of the above 21. An RNA molecule has the following sequence region 1 region 3 5 CAUCCAUCCAUUCCCCAUCCGAUAAGGGGAAUGGAUCCGAAUGGAUAAC 3 A stem loop can form between A) region 1 and region 2 B) region 1 and region 3 C) region 2 and region 3 D) A andB E) A, B and C of the following classes of RNA is correctly paired with its function? ribosomal RNA: catalyzes poly-A tail elongation 3 messenger RNA: shuttles amino acids to the ribosome C) small nuclear RNA: catalyzes the removal of introns from eukaryotic messenger RNAS D) transfer RNA:shuttles nucleotide triphosphates to the ribosome mic RNA: has no known function Page 3 of 8

Explanation / Answer

16. This figure is of a ribonucleotide since it contain OH group at 2nd and 3rd carbon atom. So it can be incorporated into mRNA and tRNA. Hence, option “d” is correct.

17. Since, each ribonucleotides are linked with phosphate group of one nucleotide to another 3rd OH group. So, option “E” is correct.

18. Since in nucleic acid chain, base are attached with each other, so correct option is “C”

20. Since, anticodon is complementary to codon sequence and genetic code of tryptophan is UGG. So, its anticodon sequence will be ACC. Hence, option “b” is correct.

21. Stem loop can form between when complementary nucleotides are formed in RNA . As , region 1 and 3 are complementary to each other, so option “B” is correct.

22. Small nuclear RNA are involved in splicing, so option “C” is correct.

Hire Me For All Your Tutoring Needs
Integrity-first tutoring: clear explanations, guidance, and feedback.
Drop an Email at
drjack9650@gmail.com
Chat Now And Get Quote