A simple handheld field assay system is developed for a specific single-stranded

Question

A simple handheld field assay system is developed for a specific single-stranded virus that works on the FRET principle. The assay is performed under ambient temperature and physiological conditions (150 mM Na+, pH 7.4). The analyte provides a target DNA sequence that allows the assembly by hybridization of oligonucleotide segments, one of which bears a donor chromophore (D), the other bearing an acceptor chromophore (A).In presence of the viral DNA, the donor and acceptor are brought close together resulting in fluorescence resonance energy transfer resulting in a visually distinguishable color shift in emission. In the absence of the viral analyte, this does not occur.

In the laboratory, this device performs with high reliability, showing very few false positives and false negatives. Field trials are conducted in Canada and the Sonoran Desert in Mexico during the months of March through August. In the early months of the trials, the device seems to work well. As the months go on, the tests in Canada seem to work just as well, however the tests in Mexico seem to produce too many false negatives. What’s more surprising, is that in Mexico, most of the false negatives are produced during the daytime. At night, the results are comparable to the lab results. What do you think is going on? Analyze the assay and its activity based upon the logical biosensor model. List the analyte, recognition, transducer, and representation layers. How would you modify the assay reagents or protocols to achieve better reliability? For double points, indicate the conditions under which your redesigned assay will exhibit false negatives due to the same reasons that the original assay did. (Hint: This is a calculation problem!)

Excitation Emission D A FRET 5' TGTTAAATTATGATATATGGGCCCTAGGCCC 3 3. CTGCTGCGGGGGACAATTTAATACTATACGCTACCCGGGATCCGGGTGCGGCGGCCCCCGG 5. Viral target strand

Explanation / Answer

This variation in result is due to the variation in temperature in which the experiment is being performed.
It is due to the thermal biosensor model which is affected by the heat.
The heat which is generated using enzyme-substrate Run are used changes in solution temperature caused by thermistor or transistor and compared to a sensor with enzyme to determine the analyte concentration.

Related Questions

Navigate

• Browse (All)
• Browse A
• Subjects

---

---

Integrity-first tutoring: explanations and feedback only — we do not complete graded work. Learn more.