Academic Integrity: tutoring, explanations, and feedback — we don’t complete graded work or submit on a student’s behalf.

1.) Pick an expression vector for protein expression in E. coli, such as the pla

ID: 219029 • Letter: 1

Question

1.) Pick an expression vector for protein expression in E. coli, such as the plasmid pPROTet E, to express and purify the enzyme Streptokinase ( from Streptococcus Pyogenes)

pPROTet E Map:

pPROTet E Sequence:

Streptokinase Sequence GenBank Format:

Please, please show any and all steps that helped you arrive at your answer!

RBS 6xHN tag Aatll Xho EK site (208301 MCS Xba l z38) Avrll (349) Ltet0-1 C PPROTet.E 22 kb II Col E1 ori Sac Spe (129) Spel pPROTet.E Promoter TCGAGTCCCTATCAGTGATAGAGALIGACATCCCTATCAGTGATAGAGATACIGAGCACATCAGCAGGACGCACTGACCGAATTC TTAAAGAGGAGAAAG 1163) 10 hexamer EcoR I RBS EXHN GTACCCATG GGTCAT AAT CAT AAT CAT AAT CAT AAT CAT AAT CAC AAC GGT GGA 156 EK site GAT GAC GAT GAC AAG pPROTet.E MCSs 171 pPROTet E133 (reading frame 11: GTG GTC GAC AAG CTT GGA TCC CTG CAG GCC TCA GGG CCC GAT CGA TGC GGC CGC STOPS AT TAA TCT AGA G11 Sal Hind III BaI Pst 171 pPROTet E233 (reading frame 2,* indicates added basel GGT GGT CGA CAA GCT IGG ATC CCT GCA GGC CTC AGG GCC GGA TCG ATG CGG C STOPS Sall Hin BaPstl STOPS 171 pPROTet.E333 (reading frame 3, "indicates deleted baselb G'GG TCG ACA AGC TTG GAT CCC TGC AGG CCT CAG GGC CCG ATC GAT GCG GCC GCT TAA TTA ATT AAT CTA GA Sal HinBaPstl Apa Pvul Cla Notl Pacl Asel Xbal Restriction Map and PromoteriMC S of the pPROTet.E 6xHN Vectors. All restriction sites shown are unique. The promoter region (bases 1-170) is common to all three vectors.

Explanation / Answer

Answer
Expression vector: It is a shuttle loaded with desired fragment and transformed into its host where the desire fragment is expressing.
Cloning of desire fragment
Amplification or isolation: Desired locus is isolated from streptococcus. A locus specific primer is designed and analyse its physicochemical properties. Then after using DNA of streptococcus as template and also Forward and Reverse primer (locus specific) a PCR reaction started with 950C five minutes, continue 30 cycle with 950C for 40sec-55 to 65oC for 30 sec – 72oC for 35sec, at last 72oC for 10 min it is an extension step then stored the sample at 4oC till run on agrose gel
Gel elution
Amplified product further run on agarose gel and eluted from the gel using gel elution kit or also done this step using manually prepared solution.
Cloning
Eluted product was used to clone in expression vector at MCS (multiple cloning site) either blunt end cloning if using blunt end cutting restriction enzyme or double digestion when both the end of a sample contain restriction site. Then ligate the segment into expression vector.
Transformation
Ligated vector is used for further transformation in E.coli for that heat shock method is used in which E.coli cell treated with calcium chloride and then heat-cold cycle is applied for 1min -1.30 min
Transformed gene fragment is expressed in E.coli cell and give rise to the functional protein(enzyme). Then use of different-different methods for the isolation mad proteins.e.g ion exchange,

Hire Me For All Your Tutoring Needs
Integrity-first tutoring: clear explanations, guidance, and feedback.
Chat Now And Get Quote