«??? ACTNCATCAccATAACKIAAACAAACAACMcCMCAcccATCAAACAAKAc?a??a?a ccTT???? 1. What
ID: 219621 • Letter: #
Question
«??? ACTNCATCAccATAACKIAAACAAACAACMcCMCAcccATCAAACAAKAc?a??a?a ccTT???? 1. What is the name and function of the sequences on the diagram above from the 5' end to +170 point) Table 122 The Genetic Code 2. Please explain why the underlined sequences in the DNA provided are labsid:35 and -10. In other words, why are these locations in the DNA designated as negative numbers? (1 point) Second Position 3. What is the sequence of the mRNA? Be sure to label the 5' and 3'ends. Underline and label any important sequences in the prokaryote mRNA that are roquírod for translation. Note: You can ignore the transcription temination signal that would be present (due to the very large size of the stem-loop structure that signals transcription termination, this signal has been left out) (33 points) Sš 8 8 8 8 8 8 8 8 8 8 8 8 os 8' For 8 8 8 8 8 4. End) o > n c a > n ca > n c a > nc Third Position ( Please create a line drawing of a peokaryotic mRNA that codes for 2 proteins: Aand B. You do not have to indicate the sequence of all actual nucleotides, only those that are essential to translation (If a consensus sequence is known, please indicate what that is). but include any important components you will find on your mRNA and label them. Also, please indicate the function of any sequences provided. Be sure to label all important sequences. (2 points) 3 3 3 3 3 3 3 3 3 3 3 3 First P ACA GUU GLUC GUA 5. How would a cukaryotic mRNA look different from the one you drew for question 4? (2 points) letter codes for acids Single amino ala (alaninc) arg (arginine) aSn (asparagine) asp (aspartic acid) Sys (cysteine) glu (glutamic acid) gin (glutamine) gly (glycine) his (histidine) ile (isoleucine) leu (leucine) lys (lysinc) met (methionine) 3F-EO phs (phenylalanine) pro (proline) ser (serine) tbr (threonine) trp (tryptophan) IT tyrosine) val (valine) 6. What is the amino acid sequence coded for by this sequence? What is the "message"? Please use the single letter codes for cach amino acid to decipher the "mouage". Hints: 1) The Met amino acid is often dclcted from the finished protein in prokaryotes, 2) The message should actually say something to you in English. Write out the complete mRNA in order to show how you translate the protein! (1 point)Explanation / Answer
Q1:- Pribnow box (-10 box) acts as promoter for gene
Q2:- These sequences are designated as negative because downstream from coding region are designated as negative and upstream as positive ( right side)
Q3:-5’ GUUUGACAGCUCAUGCAUAAGCUCAGUACCAGACACCAGGACCCAUGGAAGCGAGCACUGAGACGUGACCUUAGGGC3”
AUG-initiation codon UGA stop codon
Q4:- eukaryotic mRNA would contain introns (non coding sequence) which are absent in this mRNA
Q6:- amino acid sequence will be
fMet-Glu-Ala-Ser-Thr-Glu-
Q7:- 6 amino acids
Related Questions
Navigate
Integrity-first tutoring: explanations and feedback only — we do not complete graded work. Learn more.