PLEASE ANSWER ALL OF THE FOLLOWING QUESTIONS. 1. All of the following statements
ID: 220228 • Letter: P
Question
PLEASE ANSWER ALL OF THE FOLLOWING QUESTIONS.
1. All of the following statements about lagging strand synthesis are true EXCEPT:
a) it only reqires one RNA primer
b) it forms DNA segmens called Okazaki fragments
c) the polymerase moves away from the replication fork
2. In DNA replication, what is the function of DNA pol I?
a) it removes RNA and replaces it with DNA
b) it synthesizes a small piece of RNA
c) it relieves the strain on the separated DNA strands
3. Which of the following does NOT occur in Anaphase during mitosis?
a) The cytoplasm is divided into the two daughter cells
b) Sister chromatids separate
c) Kinetochore microtubules shorten
4. Use the figure above to answer this question. What type of protein is cdc25?
a) a transcription factor
b) a kinase
c) a phosphatase
3'- GGCCTTAAGCATGCATGCAT -5'
5'- CCGGAATTC(G)TACGTACGTA -3'
5. If a replication fork is moving from right to left along this DNA structure, which strand is the lagging strand template?
a) not enough information is provided
b) top strand
6. Which of the following occurs during Metaphase I of meiotic cell division?
a) Tetrads composed of homologous chromosomes line up at the center of the cell
b) homologous chromosomes separate
c) sister chromatid pairs line up at the center of the cell
d) non-sister chromatids exchange regions of DNA
7. A gerbil is a diploid organism with 58 chromosomes. Which of the following is true?
a) a gerbil cell in G2 phase has 58 chromosomes and 116 sister chromatids
b) a gerbil cell in Prophase has 58 chromosomes and 58 sister chromatid
c) a gerbil cell in Metaphase has 58 chromosomes and 58 sister chromatid
8. At the end of elongation and during the termination of replication on the leading strand, place the following events in the correct chronological order.
I. DNA pol I synthesizes DNA
II. DNA ligase seals the nicks in the daughter DNA
III. DNA pol I removes the RNA primers
IV. DNA pol III synthesizes DNA
a) IV-III-I-II
b)I-III-IV-II
c) III-I-II-IV
9. A gene for hair color (brown vs. blond) and a gene for finger length (long vs. short) are found on two different chromosomes. If a blond haired, long fingered mother is homozygous for hair color and homozygous for finger length, what is the probability that she passes along the preference for her son to have blond hair and long fingers?
a) 0%
v) 100%
c) 25%
10. For oxytocin signaling between two neurons, what is the correct order of events?
I. an oxytocin vessicle fuses with the plasma membrane
II. an oxytocin vessicle docks with plasma membrane
III. oxytocin molecules bind to the oxytocin receptor at the plasma membrane of the receiving neuron
IV. oxytocin molecules diffuse into the synapse
a) I-III-II-IV
b) II-I-IV-III
c) I-II-III-IV
11. The independent assortment of chromosomes is due to events that occur during ______.
a) meiosis I only
b) meiosis II only
c) mitosis and meiosis II
Division Signal CDK CDK Cyclin B Inactive MPF binds cdc25 Receptor TK1 Cyclin B) TK2 Active MPE makes CDK Cyclin B) MITOSIS activates translocates TE Cyclin Genes CDK Cyclin BExplanation / Answer
1. a) it only requires one RNA primer
In lagging strand synthesis, many small RNA primers are required which forms the Okazaki fragments.
2. a) it removes RNA and replaces it with DNA
During DNA replication DNA polymerase I removes the RNA primers and fills it with DNA along the 5'-3' direction also proofreads the new strand.
3. a)The cytoplasm is divided into the two daughter cells.
The cytoplasm divides only in late telophase.
4. c) a phosphatase
In the diagram, cdc25 is seen removing the phosphate group from CDK-cyclin B complex and making it active, so it is acting as a phosphatase.
Related Questions
drjack9650@gmail.com
Navigate
Integrity-first tutoring: explanations and feedback only — we do not complete graded work. Learn more.