The above sequence shows a partial sequence of the lac operon which contains the
ID: 222151 • Letter: T
Question
The above sequence shows a partial sequence of the lac operon which contains the following elements. CRP Binding site -35 and -10 promoter operator binding site sequence transcriptional start site RBS-ribosomal binding site The initial 58 bps of the LacZ coding sequence (CDS)-in other words the sequence that encodes for lac Z. Use the above information to answer the following: A. What would be the first 20 bases, starting from the 5' end of the mRNA sequence? B. What is the purpose of the -35 and -10 and what protein binds to it? What is the meaning behind numbers? C. What is the RNA sequence of the 5' UTR (untranslated region). D. What is the RNA sequence of the ribosomal binding site. E. What are the first 5 amino acid sequences for lac Z (you will be given the universal table class)? F. What would happen to the resulting protein sequence if we were to delete 2 bases from position 91-92? G. 1) What is the difference between an operator and a promoter? Illustrate and explain an operon that is subject to both positive and negative control containing the operator region, the operon, the promoter, the activator binding site, and functional genes in a DNA sequence. Also compare and contrast the roles activators and repressors have in regulating the illustrated operon. Explain the function of cAMP in catabolite repression. Explain the sequence of events that would follow the addition of lactose to a growing culture of E. ocli that was initially supplemented with glucose 30 minutes prior. Draw a growth curve illustrating what would happen.Explanation / Answer
Answer-
First 20 base in mRNA from 5' end will be
5'aauuguuauccgcucacaau3'
This sequence will be complementary to the sequence in operon operator because mRNA translation starts from this point.and this is RNA start site.
B) -35 and - 10 are the sequence that are interaction site for sigma 70 subunit which is a subunits of RNA polymerase.- sign indicates these sequence are preceding the RNA start site .
C)The 5' UTR sequence in mRNA will be
5'agccguuuccuguguga3'
It is the sequence just upstream of the coding sequence.
D)The ribosome binding site of the mRNA is known as shine dalgarno sequence which locates in 5' UTR sequence
On mRNA this sequence will be
5'UUCCU 3'
Which is the complementary for The RBS (AGGAA) present in operon gene.
E) first 5 amino acid for z lac gene will be
3' n met,the,met,like,thr5'
H.Promoter is a sequence where RNA polymerase binds and start transcription.It locates upstream to the mRNA coding sequence . Promoter is a regulatory sequences where regulatory proteins binds.it is also locates upstream of mRNA coding sequence and overlaps promoter sequence.
Related Questions
drjack9650@gmail.com
Navigate
Integrity-first tutoring: explanations and feedback only — we do not complete graded work. Learn more.