Academic Integrity: tutoring, explanations, and feedback — we don’t complete graded work or submit on a student’s behalf.

The following is the sequence of bases in the sense strand of a DNA segment and

ID: 222457 • Letter: T

Question

The following is the sequence of bases in the sense strand of a DNA segment and contains the beginning of a gene. DNA 3' ATATXIACCAGGCATGGACCCCCGG6ATC5' Based on this sequence, write the sequence of the anti-sense DNA strand, label the 5' and 3' ends. Now write the mRNA sequence that gets transcribed from the above sequence. Label the 5' and 3' ends. The start codon in this organism is AUG. Underline where the start codon is in your sequence. What amino acids does this mRNA code for? If the mRNA sequence encodes an operon that is controlled by both negative control and attenuation, what two regulatory sequences must be present in the mRNA?

Explanation / Answer

Answer :

1. 3' ATATTTACCAGGCATGGACCCCCGGGATC 5'

5' TATAAATGGTCCGTACCTGGGGGCCCTAG 3'