3. The following is part of a gene 5\' ATG ACC GGC AAT CAA CTA TAT TGA 3\' 3\' T
ID: 223892 • Letter: 3
Question
3. The following is part of a gene 5' ATG ACC GGC AAT CAA CTA TAT TGA 3' 3' TAC TGG CCG TTA GTT GAT ATA ACT 5' nucleotide a) Determine the amino acid sequence of the protein encoded by this sequence using the genetic code provided on the next page. (l p) Give the altered amino acid sequence of the protein that will result from each of the following mutations (2 pts) b) A transition at nucleotide 11 c) A transition at nucleotide 13 d) A one-nucleotide deletion at nucleotide 7 e) An A T transversion at nucleotide 15Explanation / Answer
a) Met T G N Q L Y Stop
b) transition at nucleotide 11 means changes a purine nucleotide to another purine (A G)
therefore, nucleotide sequence will be atgaccggcaGtcaactatattga and it will produce Met T G S Q L Y Stop.
c) transition at nucleotide 13 means changes a pyrimidine nucleotide to another pyrimidine (C T)
therefore, nucleotide sequence will be atgaccggcaatTaactatattga and it will produce Met T G N Stop L Y Stop.
d) a nucleotide deletion at position 7 means nucleotide sequence will be atgaccgcaatcaactatattga and it will produce Met T A I N Y I .
e) A to T transversion at nucleotide 15 means nucleotide sequence will be atgaccggcaatcactatattga and it will produce Met T G N H Y I.
Related Questions
drjack9650@gmail.com
Navigate
Integrity-first tutoring: explanations and feedback only — we do not complete graded work. Learn more.