Use the provided codon table to answer the following questions. For each questio
ID: 254541 • Letter: U
Question
Use the provided codon table to answer the following questions. For each question, you lose a %a point for your first mistake and another 14 for your second. So be carefu!! this seq rGCCCGGCTTTACTGCTTGCACTTATATT 6. (5 points) You are given the following sense DNA strand as a template. ATCACCATGCCCGGGTTTACTGTTGCACTTATATTCTTGAACAAGAAATAGTATGACATT CTTGAACAAGAMATAGTATG a) Replicate this sense strand to create double-stranded DNA. Be sure to add your 5' and 3' ends to ted DNA strand, express it as a polypeptide and compare it to the one ated in #6b. Circle the amino acids that differ from the original sequence given at the start of generate this question. b) Using this DNA double helix, express the gene and determine the resulting polypeptide sequence. UAA Stop UGA Stop A UAG UCA CGC Arg CAA Gin CGA CGG 1st CUA c) Does this DNA sequence have 5' and 3' UTR sequences? If so - write them in the space below AAU Asn AGU Ser Al AUC | ue AUA AUG Met ACG G GUC Va GCC Ala GAC GUAExplanation / Answer
Answer
6a, b & c).
d). The following mutations are happened
1.Transversion- Cytosine (pyrimidine) is replaced by Guanine (purine)
2. Frameshift mutation (Insertion)
e).
DNA-Template 3' A T C A C C A T G C C C G G G T T T A C T G T T G C A C T T A T A T T C T T G A A C A A G A A A T A G T A T G A C A T T 5' DNA-coding 5' T A G T G G T A C G G G C C C A A A T G A C A A C G T G A A T A T A A G A A C T T G T T C T T T A T C A T A C T G T A A 3' Transcribed mRNA 5' U A G U G G U A C G G G C C C A A A U G A C A A C G U G A A U A U A A G A A C U U G U U C U U U A U C A U A C U G U A A 3' Polypeptide 5' untranslated region Met Thr Thr STOP 3' untranslated regionRelated Questions
Hire Me For All Your Tutoring Needs
Integrity-first tutoring: clear explanations, guidance, and feedback.
Drop an Email at
drjack9650@gmail.com
drjack9650@gmail.com
Navigate
Integrity-first tutoring: explanations and feedback only — we do not complete graded work. Learn more.