Design a pair of primers (~20 nucleotide long) for amplification of the gene sho

Question

Design a pair of primers (~20 nucleotide long) for amplification of the gene shown in lowercase and shaded from the following one strand of a DNA sequence. Note it has an ATG as a start codon and TAA as a stop codon. a. Determine the GC content of your primers. b. Determine the number of amino acids in the protein coded by this gene? c. Determine the molecular weight of the protein that is coded by the following gene. 3. GTATCGATAAGCTTGATATCGAATTCatgatttctattgtattggaattgttccagaacttgtgctgctgtcgcggattttccgatgctactattagggtaa atgataaacgatataggattcaacgactacttggagaaggtggaatgtcctttgtgtatttggtacaactgtcaaagaattctctgattatagacaacggcatcgca acaccagaattatacgcactaaagaagattatttgtcctagtgtggaaagtatatccaatggtatgcgagaaattgaaaattacaaacggtttcaaagtccttatgt tataaaaagtatcgactcacaagtaatgcaggaaaaagatgggtcagaaaacaatttacatagtactaccctattattcattaggtaaAAAAGGAAATAGT TGTAGAAACGCTAA

Explanation / Answer

Answer Forward primer = 5'CATAGCTATTCGAACTATAG3' AND

Reverse Primer 3' TTATCAACATCTTTGCGATT 5'

a. 7 [GC] out of 20 bases in forward primer means 35% GC content and for reverse primer 6 [GC] out of 20 bases i.e 30% GC content

b. one amino acid is coded by three bases. here in DNA total no of bases are 381, that means 381/3=127 amino acid. but TAA is stop codon so excluding this total number of amino acid is 126 amino acid.

C. Amino acid molecular weight is 110 Da then for 126 aa the molecular weight is 13860 Da.

Related Questions

Navigate

• Browse (All)
• Browse D
• Subjects

---

---

Integrity-first tutoring: explanations and feedback only — we do not complete graded work. Learn more.