5\' 1) Daniel is trying to design a PCR primer that will only bind once, on the

Question

5' 1) Daniel is trying to design a PCR primer that will only bind once, on the gene above (only the bottom strand is shown for simplicity) Where will the primer TCCTGA bind? Draw it base-paired to the above piece of DNA b. Why shouldn't Daniel usethe primer TCCT - 2) What are the 3 heating steps of a PCR reaction? Describe what happens during each of them: Name of step 1. 2. 3. 9 3) Fill out the missing information on the following table about the components of a PCR reaction What happens during this step? Denatire onal fubn Reagent What does it do/what is its purpose? Maintains a constant pH, and contains cofactors for enzymes to work 4 Forward & reversevinmen (s) Heat tolerant enzyme, responsible for making a new DNA strand Template DNA

Explanation / Answer

3’ CCTAAGGACTGCATAGCATAGCAGGACCTGAGATTAGATTAGTCCTGACATCGGATAAA 5’

Daniel shouldn’t use the primer TCCT, because this primer binds to the two highlighted region (above mentioned) of the DNA.

--------------------------------------------------------------------------------------------------------------------

Forward and reverse primer binds to the specific region of Forward and reverse strand of DNA template.

--------------------------------------------------------------------------------------------------------------------

dNTP's is added. To extend the DNA chain by polymerase , nucleotide is required.

--------------------------------------------------------------------------------------------------------------------

Related Questions

Navigate

• Browse (All)
• Browse 5
• Subjects

---

---

Integrity-first tutoring: explanations and feedback only — we do not complete graded work. Learn more.