I need assistnace with questions 8-11 Homman Name 5\'UTR S\'UTR Gene to Protein

Question

I need assistnace with questions 8-11

Homman Name 5'UTR S'UTR Gene to Protein Worksheet Start Codon Step pre - mRNA - 5' AUGAGGUAUCAGGGGC GCAAA UGA 3' downstream DNA up stream 5GGGCCTATATTAATATACGCCATGAGGTATCAGGGGCGCAAATGATGAAATAAA3 3CCCGGATATAATTATATGCGGTACTCOATAGTCCCCCCGTTTACTACTTTATTTs - ??? - template +1 up stream down Stan? promoter Stream Si+e 1. Label the template and coding strand. Label upstream and downstream ends. 2. On the template strand identify the promoter. 3. Identify the start site. 4. Block off and number the triplets to be transcribed. 5. Create the pre-mRNA. Label 5' and 3' ends. 6. Using the codon table for mRNA (genetic dictionary), identify the start and stop codons. 7. Identify the utrs (untranslated regions). 8. Add a 5' cap to the 5' end of the mRNA transcript and a poly-A-tail to the 3' end. 9. Block off and number codons that can be translated into amino acids. 10. Codon 5 is an intron. Remove it. 11. Using the codon table for mRNA, translate remaining exons. Add an amino and carboxyl group to the appropriate ends of the polypeptide in its primary structure.

Explanation / Answer

8. methyl guanosine group is the 5' CAP.

9. AUGAGGUAUCAGGGGCGCAAA

1.AUG, 2.AGG, 3.UAU, 4.CAG, 5.GGG, 6.CGC, 7.AAA.

Out of the above codons, 5th codon is an intron as per the below given statement. so it is not going to be considered to produce the peptide sequence. so except the 5th codon, the remaining codons will be translated into aminoacids.

10. GGG is the 5th codon. As it is an intron, it is going to be removed.

11. 1.Methionie, 2.Arginine, 3.Tyrosine, 4.Glutamine, 5.intron-so not translated, 6.Arginine, 7.Lysine.

Hence the peptide sequence as follows with amino and carboxyl groups added.

NH2-Met-Arg-Tyr-Gln-Arg-Lys-COOH

Related Questions

Navigate

• Browse (All)
• Browse I
• Subjects

---

---

Integrity-first tutoring: explanations and feedback only — we do not complete graded work. Learn more.