(a) Discuss the role of the lac Z gene in gene cloning. (6 marks) A manti) (b) W
ID: 262470 • Letter: #
Question
(a) Discuss the role of the lac Z gene in gene cloning. (6 marks) A manti) (b) What are shuttle vectors? (a) From a gene cloning experiment, you have isolated a cDNA fragment for protein X. If you use this cDNA fragment as a probe to hybridise a Northern blot, how many possible bands would you expect to see? Explain. Using the same cDNA 4. probe to hybridise a Southern blot, there were two bands observed. Explain. (5 marks) b) From the following sequence, draw the pattern you would expect to see on the autoradiograph of a sequencing gel if Maxam and Gilbert's DNA sequencing method was used and the 5' end of the DNA template was labelled. (5 marks) 5'TAGAGCGGCCACTGGGAGCT3Explanation / Answer
3. Gene cloning is an important technique of amplifying the number of copies of desired gene, by combining it with a self replicating genetic element called Plasmid.
LacZ gene is an important gene which codes for an enzyme beta- galactosidase. In gene cloning this gene plays an important role as it causes bacterial host cells to produce blue colonies when grown on a medium containing a compound xgal. This compound is analog of lactose. Thus lacZ gene helps us to differentiate cells that have taken up recombinant molecules.
(b). Shuttle vector as the name suggests can be shuttled between two different hosts. It replicates in more than one unrelated host organisms. With the help of these vectors DNA can be cloned in one organism and then carried to another. Thus it allows movement of genes between hosts.eg it clones in E.coli and can express in other host
The characteristic feature of this vector to survive in two different organisms is that it has two origins of replication ( one for each organism) and two genes for selection ( one for each organism). It is also called bifunctional vector.
Related Questions
Navigate
Integrity-first tutoring: explanations and feedback only — we do not complete graded work. Learn more.