Practice question (to do at home will be on next RQ) rS RNA polymerase GGAAATATT

Question

Practice question (to do at home will be on next RQ) rS RNA polymerase GGAAATATTCTGTGGTCAACATAGC Readin Strand - ATGTTTGATCTA AACATAGCTTTGTGA -3 ??111 1. Which DNA strand is the template strand? 2. Draw the first base of the RNA (the arrow marks the transcription start site). This will be the 5' end of the NEW mRNA strand. 3. Draw the next 10 bases of RNA that will be made. To which side of the first base will you add these next 10? Which of the following is the correct sequence of the first 10 bases of the mRNA made? 5' AAGTCCTGGG 3 5 GGGUCCUGAA 3' 5' CCCAGGACUU 3 5' GGGAAAUAUU 3 5' CUUUAUAAGAC 3' 5 CAGAAUAUUUC 3

Explanation / Answer

Practice question (to do at home will be on next RQ) rS RNA polymerase GGAAATATT

Related Questions

Navigate

• Browse (All)
• Browse P
• Subjects

---

---

Integrity-first tutoring: explanations and feedback only — we do not complete graded work. Learn more.