Identify/name the mutations (at the DNA level) AND predict the effects (at the p

Question

Identify/name the mutations (at the DNA level) AND predict the effects (at the polypeptide level)

3’ TTCTACAGAGTTATATCCACTGAG 5’

5’ AAGATGTCTCAATATAGGTGACTC 3’

a) Which is the coding strand, which is the template? Why?
b) Write out the amino acid sequence of the polypeptide produced after transcription and translation.

c) If the A was mutated to a C, what kind of mutation (DNA) would this be? How would the polypeptide be affected? What kind of polypeptide mutation would this be?

d) If the C was mutated to a T, what kind of mutation (DNA) would this be? How would the polypeptide be affected? What kind of polypeptide mutation would this be?

e) If the T was mutated to a G, what kind of mutation (DNA) would this be? How would the polypeptide be affected? What kind of polypeptide mutation would this be?

f) If the T was deleted, what kind of DNA mutation would this be? How would the polypeptide be affected? What kind of polypeptide mutation would this be?

Explanation / Answer

Identify/name the mutations (at the DNA level) AND predict the effects (at the p

Related Questions

Navigate

• Browse (All)
• Browse I
• Subjects

Integrity-first tutoring: explanations and feedback only — we do not complete graded work. Learn more.