GENE 1 ATGTTATTAGAACTTGCTAAAAAAAGAAAAACAGTAAGGATTTTTTCAGACAAAAAGCCAGATATTGAGGATA

Question

GENE 1

ATGTTATTAGAACTTGCTAAAAAAAGAAAAACAGTAAGGATTTTTTCAGACAAAAAGCCAGATATTGAGGATATAAAATATGCTATAAATGTTGCAAAGGAAGCACCATCTGGTATGAATGCACAGCCTTGGCATTTTAAAATAGTAGATGCTCAAAAAGAAAAAGAAAAAATCAGAGAAATTGTAGAGAAAGAGGAGAGAAAGTTTTATGAATCTTCAAAAGGGAAATTAAAAGAATTTTTGAAAAATGCTAATATCACTTGGAAAAAGGAATTTTTAACTCAAGCTCCTTATCTTTTATTTGTTTATTCCGATAAAAGTGCACCTTTTTCCAAAGAATCCACTGGCTAGCAATAGGTTATTTGTTATTAGCTCTTGAAGAAATAGGTCTTTCTACTGTAACGTATACCCCTCCAAATCTAAATGATTTTTCTTTTGGAAATTATAAACTAGAGGTTATTCTTCCAATTGGATATGAATGATCCAAAGGAAAAATATCACCGAAAAAATATAGATGAAATTATTTCTTTTAATGATATTTTTTGA

INSTRUCTION: this is the provided gene by our instructor! can someone please help with this, we need to copy each gene into the nebcutter, and have to get a forward primer, by using the nebcutter website, then copy 15 neucleotide for the primer and add the enzyme that doesn't cut to the front of the gene and to the end of the gene, then we have to find a melting temperature of the forward primer using Oligoanalyzer 3.1 website, so copy the forward primer that you made and pate it in this website and that will give you the melting temp. do the same with reverse primer but also use the reverse complement website to copy 13 nucleotide at the end of the same gene and pasting it in the reverse complement to get the reverse primer, then add the enzyme that do not cut the front and the back of the gene also find the melting temp. by using the same website using website mentioned earlier, you have to make sure that the melting temo. of forward primer is close to 5% to reverse primer. so you will have to do average annealing, (average Tm-5) then do the PCR program...

please help it will be very much appriciated!

Thank you!!!

Explanation / Answer

Zero cutters in the given sequence:

BamHI, BglII, EcoRI, KpnI, and EcoRV

We can use any enzyme pair from the above list. Let us consider BamHI and KpnI pair.

Forward primer: GCA-GGATCC-ATGTTATTAGAACTT

Tm = 32.4'C

Reverse primer: CGA-GGTACC-TCAAAAAATATCATTA

Tm = 33'C

Tm values are for the sequence excluding the restriction site and extra nucleotides.

Related Questions

Navigate

• Browse (All)
• Browse G
• Subjects

Integrity-first tutoring: explanations and feedback only — we do not complete graded work. Learn more.