The above example demonstrates how PCR m we have seen, different people often co

Question

The above example demonstrates how PCR m we have seen, different people often contain identical DNA sequences that are separated from each other by intervening repeats of differing number. In the example below, both Joe and Howard have sequences ay be used to detect a sequence difference. However, as GCCTTA and ACCGGGGTAT, but Joe between these sequences, while Howard has only 200 base one copy of this chromosome, but remember, in has 400 bases of repeated GCC DNA (shown below in gray) s of GCC repeats. (We are only considering of this chromosome that might have a different number of repeats in addition to the one shown below) reality both Howard and Joe would have a second copy Howard: ATGCCTTAGCCGCC- 400 bases - GCCGCCGCCGCCGCCACCGGGGTAT Joe: ATGCCTTAGCCGCC- 200 bases - GCCACCGGGGTAT It turns out that you can also use PCR to look at these differences in length of a stretch of DNA. This isa technique called DNA Fingerprinting. Think about this: neats or to the ATGCCTTA and How would you visualize the PCR results? What would you see if you did this experiment with Howard and Joe?

Explanation / Answer

Ans- a

we would design our primer for ATGCCTTA and ACCGGGGTTA because GCC is SSR (simple sequence repeats) and this type of sequences are immense in the genome so spurious amplification will affect the result.

Secondly in principle, DNA fingerprinting employs sequences which are unique for particular person hence ATGCCTTA and ACCGGGGTTA are sequences unique to Howard and Joe's genome.

Ans b

PCR results can be visualised by incorporating DNA staining dye syber safe in agarose gel and running the PCR products on it.

Ans c

In one lane PCR sample of Howard is loaded and in another PCR sample of Joe is loaded and both the samples will give bands at same position hence it is confirmed that the two samples are identical in nature and both share similar DNA sequences.

Related Questions

Navigate

• Browse (All)
• Browse T
• Subjects

---

---

Integrity-first tutoring: explanations and feedback only — we do not complete graded work. Learn more.