Familial erythrocytosis is a rare genetic disorder, characterized by an increase
ID: 267433 • Letter: F
Question
Familial erythrocytosis is a rare genetic disorder, characterized by an increased production of red blood cells. This excess of red blood cells can lead to the formation of blood clots, resulting in higher risk for strokes and heart attacks. Mutations in various genes have been associated with for the onset of the condition. In particular, those affecting the EPOR gene (erythropoietin receptor) result in a form of Familial erythrocytosis, which is transmitted in an autosomal dominant pattern.
A group of researchers seeked to study a new mutation in EPOR affecting family X. They first designed PCR primers flanking different regions of the EPOR gene:
Primer 1: 5? GGCTCTGAAGCAGAAGATCT 3? binds between nucleotides 5419bp-5438bp
Primer 2: 5? CCAGTGGGCAGTGAGCATGC 3? binds between nucleotides 5758bp-5777bp
Primer 3: 5? TCCTGCTCATCTGCTTTGGCC 3? binds between nucleotides 5899bp-5919bp
Primer 4: 5? CTGAGAGAGGCCTCGCCAT 3? binds between nucleotides 6308bp-6290bp
Primer 5: 5? GTCATATTGGATCCCTGATC 3? binds between nucleotides 6250bp-6231bp
Primer 6: 5? GCCAGAGTCAGATACCACAAG 3? binds between nucleotides 6075bp-6055bp
Look at Figure 1 and match the primers above with the primers labeled by a letter on the figure.
Primer 1 is ,
Primer 2 is ,
Primer 3 is ,
Primer 4 is ,
Primer 5 is and
Primer 6 is .
The authors selected primers D and F to target the desired sequence of DNA. This resulted in the amplification of a fragment which length was bp.
The amplified DNA from each family member was then digested with the RsaI restriction enzyme. The distance between the RsaI sites are shown in Figure 1. The gel electrophoresis results are shown in Figure 2. The Figure also shows the family pedigree tree, each member is placed above the lane into which their samples were loaded
In the table below identify which individual would suffer from familial erythrocytosis (this would be equivalent to darken the circles or squares in the pedigree tree). Write A next to a subject if affected, N if not affected.
Individual III 3 marries a man who is not affected by Familial erythrocytosis.The genotype of individual III 3 is and her partner's is .What would be the chance in percent for them to have a non affected child?
I 1 2 II 1 2 3 4 5 III 1 2 3 Exon 7 Exon 8 RRNormal allele 64 bp Location of the deletion Mutant allele Figure 1: Diagram of exons 7 and 8 of the EpoR gene. The coding sequences are shown as solid boxes. The lettered arrows indicate the position and orientation of the PCR primers. R shows the sites recognized by the Rsal restriction enzymeExplanation / Answer
Primer 1 === A
Primer 2 ===C
Primer 3 == F
Primer 4==D
Primer 5 == E
Primer 6 == B
Product size will be 411
Related Questions
Navigate
Integrity-first tutoring: explanations and feedback only — we do not complete graded work. Learn more.