3. A research team sequenced a human gene and the corresponding mRNA. Here is th

Question

3. A research team sequenced a human gene and the corresponding mRNA. Here is the sequence of the genomic DNA. The parts that are identical between the genomic DNA and the mRNA are written using uppercase letters. 4.Gene B has 390 Guanine and the total number of hydrogen bonds is 1670, is substitution mutated in 1 pair of nucleotides to gene b. Gene b has 1 hydrogen bond more than gene B. Calculate each type of nucleotide in gene b. 5. Gene X has 3600 hydrogen bonds and the number of nucleotide Adenine is equal to 30% the number nucleotide of the whole gene. Gene X is mutated type deletion 1 pair of nucletode A-T to gene x. A cell with heterozygote genotype Xx undergoes mitosis to 2 daughter cells. Please calculate each type of nucleotide that the environment need to provide to the process. 6. A gene D has 4800 hydrogen bonds and the ratio of nucleotide number Adenine/Guanine = 1/2, , is substitution mutated in 1 pair of nucleotides to gene d with 4801 hydrogen bonds. Calculate each type of nucleotide in gene D and d. 7. Gene A with 3000 hydrogen bonds and the number of nucleotide Adenine is equal to Guanine, is mutated to gene a. When gene a underwent DNA replication, the environment provided 2398 nucleotides. Which kind of mutation that gene A had? 4.Gene B has 390 Guanine and the total number of hydrogen bonds is 1670, is substitution mutated in 1 pair of nucleotides to gene b. Gene b has 1 hydrogen bond more than gene B. Calculate each type of nucleotide in gene b. 5. Gene X has 3600 hydrogen bonds and the number of nucleotide Adenine is equal to 30% the number nucleotide of the whole gene. Gene X is mutated type deletion 1 pair of nucletode A-T to gene x. A cell with heterozygote genotype Xx undergoes mitosis to 2 daughter cells. Please calculate each type of nucleotide that the environment need to provide to the process. 6. A gene D has 4800 hydrogen bonds and the ratio of nucleotide number Adenine/Guanine = 1/2, , is substitution mutated in 1 pair of nucleotides to gene d with 4801 hydrogen bonds. Calculate each type of nucleotide in gene D and d. 7. Gene A with 3000 hydrogen bonds and the number of nucleotide Adenine is equal to Guanine, is mutated to gene a. When gene a underwent DNA replication, the environment provided 2398 nucleotides. Which kind of mutation that gene A had? 3. A research team sequenced a human gene and the corresponding mRNA. Here is the sequence of the genomic DNA. The parts that are identical between the genomic DNA and the mRNA are written using uppercase letters agcgaaatttaatgagcgtgtaacaggggactgaaaatcctgatttctcaAGCTATCAAA del 1 GGTTTATAAAGCCAATATCTGGGAAAGAGAAAACCGTGAGACTTCCAGATCTTCTCTGGT GAAGTGTGTTTCCTGCAACGATCACGAACATAAACATCAAAGGATCGCCATGGAAAGgta del 2 agtgtgacaactcactgcgttggtggctcgcgttcttatgagctaagGGTCCCTCCTGCT GCTGCTGGTGTCAAACCTCCTCCTGTGCCAGAGCGTGACCCCCTTGCCCATCTGTCCCGG Del 3 CGGGGCTGCCCGATGCCAGGTGACCCTTCGAGACCTGTTTGACCGCGCCGTCGTCCTGTC CCACTACATCCATAACCTCTCCTCAGAAATGTTCAGCGAATTCgtaagtaccatgcttct 4

Explanation / Answer

4) Given Total number of hydrogen bonds in gene b are 1671

Accordingly, Number of guanine in gene b should 391

Guanine pairs with cytosine with 3 hydrogen bonds. So 391 * 3 = 1173

Total number of H bonds - H bonds between G and C = 1671-1173 = 498

So 498 are H bonds between adenine and Thymine and they bind with two hydrogeb bonds. So 498/2 = 249 Adenine and thymine

So Guanine = 391

Cytosine = 391

adenine = 249

thymine = 249

Related Questions

Navigate

• Browse (All)
• Browse 3
• Subjects

---

---

Integrity-first tutoring: explanations and feedback only — we do not complete graded work. Learn more.