Page 4 . (4 points) A newly discovered virus has 9 genes, labeled A through I en
ID: 270790 • Letter: P
Question
Page 4 . (4 points) A newly discovered virus has 9 genes, labeled A through I encoded by the viral DNA. DNA from 100 infected patients is sequenced, and the various symptoms in each infected patient are recorded. The table below shows representative results of the DNA sequence analysis (the s indicate specific alleles present in the viruses isolated from each patient): Viral uperscripts Patient Allele A: a) If patients number 2, and 6 are the only ones that have had tumors form in cells infected with the virus, then what allele(s) is/are responsible for this symptom? b) What is your evidence for that conclusion? e) Propose a detailed hypothesis for how a viral protein could cause an infected cell to become cancerous. d) You are tasked with determining if this virus is related to a previously known virus and given the following sequence to use in this search: TTTGA TGAAAGGA GGAACAAA TACCTO?TAA GAA CA TCCCAGTGGGGGGAAGTACCCAAAGAAAACTGGAG GTCCAATCTACCGAAGAAGAGACGGAAAATGGGTGAGAGAGCTGATTTTGTATGACAAAGAGGAGATCAG GAGAATTTGGCCTCAAGCGAACAATGGAGAAGATGCAACTGCTTGTCTCACTCACATGATGATCTGGCAT TCCAATCTAAATGATCCCACATACCAGAGAACAAGAGCTCTCGTGCGTACTGGGATGGACCCTAGAATGT GCTCTCTGATGCAAGGACCAACTCCCCCGAGGAGATCTGGAGCTGCTGGTGCGGCAGTAGAGGGAGTCGG AACGATGGTAATGGAACTAATTCGGATGATAAAGCGAGGGATTAACGATCGGAATTTCTGGAGAGGTGAA AATGGGCGAAAAACAAGAATTGCATATGAGAGAATGAGCAACATCCTCAAAGGGAAATTCCAGACAGCAG CACAAAGAGCAATGATGGATCAGGTACGGGAAAGCAAAGAACCTGGGAATGCTGAGATTGGAGATCTCAT Given the above sequence, what is the most closely related virus, and what is the likely function(or name) of the protein, if any, encoded by this gene?Explanation / Answer
a. The allele responsible for the tumour is G.
b. Since patient 2 and 6 only have tumours, G allele is the only allele common to both of them and not found in any of the patients.
c. DNA tumour causing viruses encode genes for oncoproteins that may be essential for viral replication and transformation. Viral proteins once formed after utilising the host machinery slowly hijack the cells, interact/complexes with several proteins to affect cell cycle progression or affect the tumour suppressors. Thus cell proliferation and growth of host cells increase as virus modulates the host genetic machinery/ gene expression for its survival/replication. Proto-oncogenes like GPCRs, cell cycle proteins, p53, myc,ras etc may get activated/repressed depending upon the cell type.
d. CHEGG rules - If question has multiple sub parts answer 3 of them.
For last question though Use BLASTn tool and paste the sequence . One will be able to find the gene. Look whether the gene is an oncogene and found in any virus. Probable function of viral gene encodes around viral replication annd packaging.
Related Questions
Navigate
Integrity-first tutoring: explanations and feedback only — we do not complete graded work. Learn more.