30) A c.8G C mutation from the wild type has occurred in the following sequence

Question

30) A c.8G C mutation from the wild type has occurred in the following sequence (making this the mutant sequence). Beginning from the start codon, answer the following: 5- ATGGTTACTCAATGTTCTTTAATT -3' A) Give the wild-type polypeptide using single letter codes (4 pts) B) Give the mutant polypeptide using single letter codes (4 pts) C) In terms of polypeptide properties (polar, nonpolar, basic, acidic, aromatic), how is the mutant different from the wild-type (4 pts)? D) Using the DNA base pairs (basically like SNPs) create a Punnett square with a heterozygous wild- type/mutant mating to a heterozygous wild-type/mutant (6 pts) E) What is the percent chance of carriers (from D above) if this mutation is dominant (4 pts)? F) What is the percent chance pf affected (from D above) if this mutation is dominant (4 pts)? 31) The carriers of a mutation are all resistant to cholera but have fewer children. List the Hardy Weinberg assumptions in order of importance to these carriers (most important first) AND describe why you picked this order (10 pts).

Explanation / Answer

Answere :

1. Met-gly-thr-gln-cys-ser-leu-ile or M-G-T-Q-C-S-L-I

2. Met-gly-ser-glc-cys-ser-leu-ile or M-G-S-Q-C-S-L-I

3. The wild type contain threonine in thier polypeptide chain and mutant type contain serine in thier polypeptide chain. Both are polar neutral amino acids.

Related Questions

Navigate

• Browse (All)
• Browse 3
• Subjects

---

---

Integrity-first tutoring: explanations and feedback only — we do not complete graded work. Learn more.