I need help with this evolution question please 1. The images below is DNA seque
ID: 302986 • Letter: I
Question
I need help with this evolution question please
1. The images below is DNA sequence (in reading frame) and the amino acid translation for homologous regions of a protein coding gene for two species you are researching cies/Abbrv 1. Pan troglodytes ATGCCCSTACETAGGSICCAGACEATAGTACGATATCATACGTGGGAAACGATCGAGTCTAAAGCAAAGTGACATIGECATGGGTC Species/Abbrv 1. Pan troglodytes MPVRRTIVRY 2. Gorilla gorilla MGRRV Q P By comparing the two alignments and/or using the translation table provided (remember U = T) mark all of the mutations in the DNA alignment as either non-synonymous (N) or synonymous (S). Place either an "N" or an "S" in the space above the mutation in the DNA alignment. a. A GIU CA UIA C Leucine Asparagine A Aspartic Leucine A U b. How many non-synonymous mutations (N) are there? STOP CUGAC G4CUG4C c. How many synonymous mutations (S) are there? d. What is the dvids? How is this different than the Ka/Ks ratio? If the value from part d. above was an adusted Ka/Ks ratio, would you estimate the gene had been under selection in these lineages or has it been evolving neutrally? If it is under selection, what type of selection pressure is at work? e.Explanation / Answer
a.
DNA aligment C-->A Non synonymous
T--> G synonymous
T---> A Non synonymous
C---> T Non synonymous
T---> A synonymous
A--->T non synonymous
T---C non synonymous
C--->G, G--->C synonymous
G--->T, G---T synonymous
T--->C non synonymous
A---C synonymous
C---->G synonymous
G--->C synonymous
C--->A, A--->C synonymous
2. Total number of non synonymous mutations are 6
3. Total number of synonymous mutations are 11
4. It is referred as nucleotide substitutions in genes coding for proteins can be either synonymous or non synonymous and this is calculated by this ratio. If the ratio is below it is negative selection, abobe 1 for positive selection and 1 means neutral selection.
Ka/Ks ratio is used to estimate balance between neutral mutations, purifying selections and beneficial mutations.
4. From the mutations the dN/dS ratio 6/11 which is less than 1. So the population is in negative selection.
Related Questions
drjack9650@gmail.com
Navigate
Integrity-first tutoring: explanations and feedback only — we do not complete graded work. Learn more.