Academic Integrity: tutoring, explanations, and feedback — we don’t complete graded work or submit on a student’s behalf.

Question 1) Consider that the following double stranded DNA is your gene of inte

ID: 313090 • Letter: Q

Question

Question 1) Consider that the following double stranded DNA is your gene of interest and that the bottom strand is transcribed. Please indicate the mRNA sequence that will be generated after transcription of your gene and the polypeptide generated after translation. Label the 5’ and 3’ of the mRNA and the amino (“N”) and carboxyl (“C”) ends of the polypeptide. Use the genetic code table to generate your polypeptide.

         

DNA:   

5’ A T T G G A T G G C C A T T A T C T G G A A G G A A T A G T T T 3’

3’ T A A C C T A C C G G T A A T A G A C C T T C C T T A T C A A A 5’

a) mRNA:

b) polypeptide:

c) What is the sequence of bases of the anticodon (indicate 5’ and 3’ ends of the anticodon) for the third amino acid of that polypeptide?

d) How many codons are used to produce that polypeptide?

e) How many anticodons are used to produce that polypeptide?

Explanation / Answer

a) mRNA : 5l AUUGGAUGGCCAUUAUCUGGAAGGAAUAGUUU 3l

b) Amino acids : Methionine-Alanine-Isoleucine-Isoleucine--Tryptophan-Lysine-GLutamic Acid

c) 3l UAG 5l

d) 8 codons including start and stop codons

e) 6 anticodons

Hire Me For All Your Tutoring Needs
Integrity-first tutoring: clear explanations, guidance, and feedback.
Drop an Email at
drjack9650@gmail.com
Chat Now And Get Quote