You have just sequenced a short segment of DNA. You wish to analyze this DNA seq

Question

You have just sequenced a short segment of DNA. You wish to analyze this DNA sequence to determine whether it could encode a protein. Answer the following questions. 5' TCAATGTAACGCGCTACCCGGAGCTCTGGGCCCAAATTTCATCCACT 3' A. Underline the longest open reading frame (ORF) in this sequence. B. Write the RNA sequence corresponding to this ORF below from 5' to 3'. C. Is the DNA sequence shown above the template or the coding strand for this RNA (circle one)? D. Write the protein sequence encoded by this RNA below, indicating the N- and C-termini.

Explanation / Answer

A.) Longest ORF is ATG as after ATG there is stop codon TAA

B.) 5' UAC3'

C.) DNA TEMPLATE

D.) Only methionine will be translated as after ATG there is stop codon so the translation process will be terminated.

Related Questions

Navigate

• Browse (All)
• Browse Y
• Subjects

---

---

Integrity-first tutoring: explanations and feedback only — we do not complete graded work. Learn more.