10 .d 60% i 12:51 PM ts Course Topics .. The Genetic Code and Transcription Prac
ID: 3164421 • Letter: 1
Question
10 .d 60% i 12:51 PM ts Course Topics .. The Genetic Code and Transcription Practice Problems 12 The Genetic Code and Transcription ice Problems 12 The Genetic Code and Transcription - e. Termination codon f. Sense codon q. Nonsense codon 2. Below is a DNA double helix coding for a very small polypeptide 5Nontemplate 3" Stranl TATCCGCCCCAGTAAGTAATGACIA AAAATACKHGTTATICATTACTGAT 3' 5" a. What is the direction of synthesis for the mRNA? b. Draw the m-RNA that would be transcribed (labeling the 5' and 3' ends) and circle the initiator codon. c. Which end of the mRNA is transcribed first? d. Using the genetic code table, list the amino acid sequence resulting from this mRNA. e. Identify the maximum number of amino acids in a polypeptide chain produced by a DNA containing 225 nucleotides (assume no stop codon, just the reading frame of 225 nucleotides) f. The codons UGA, UAA, and UAG code for which amino acid? g. If a polypeptide is 210 amino acids long what is the minimum number of nucleotides in the mRNA molecule required for the synthesis of that chain (include a stop codon)? 3. In a mixed polymer experiment, artificial messenger RNAs were created with the ratio of bases of 1/5 C: 4/5 U. What will be the expected codons and their frequencies on the resulting RNA molecule? Using the Genetic Code table, predict the frequency/percentages of amino acids that would be found after translating this synthetic RNA. a. b.Explanation / Answer
(a) the direction is 5'-3'
(b) 5'- UUUAUGCGCCCCAGUAAGUAAUGACUA-3'.. The initiator codon is AUG AT 5' end..
(e) one amino acid is coded by a triplet of 3 codons . So 225 nucleotides means there are 75 triplet codon which will code for 75 amino acid..
(f) these are basically donot codes for any amino acids as they are stop codons and they stop the process of transcription..!
(g) 210 amino acids means 210 codon of triplet which codes for the protein three codons extra which is the stop codons.. Hence total 213 codons.. The total nucleotides are 213*3 = 639 nucleotides..!!
Related Questions
Hire Me For All Your Tutoring Needs
Integrity-first tutoring: clear explanations, guidance, and feedback.
Navigate
Integrity-first tutoring: explanations and feedback only — we do not complete graded work. Learn more.